MirGeneDB ID | Mmr-Mir-154-P30 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-154 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Gray mouse lemur (Microcebus murinus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | mmr-mir-409 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Mmr-Mir-154-P1 Mmr-Mir-154-P2-v1 Mmr-Mir-154-P3-v1 Mmr-Mir-154-P5 Mmr-Mir-154-P6a-v1 Mmr-Mir-154-P6b Mmr-Mir-154-P6c Mmr-Mir-154-P7 Mmr-Mir-154-P8a Mmr-Mir-154-P8b Mmr-Mir-154-P9 Mmr-Mir-154-P10 Mmr-Mir-154-P11 Mmr-Mir-154-P12 Mmr-Mir-154-P14 Mmr-Mir-154-P16 Mmr-Mir-154-P17 Mmr-Mir-154-P18 Mmr-Mir-154-P20 Mmr-Mir-154-P21 Mmr-Mir-154-P22 Mmr-Mir-154-P23 Mmr-Mir-154-P24 Mmr-Mir-154-P25 Mmr-Mir-154-P26 Mmr-Mir-154-P28 Mmr-Mir-154-P29 Mmr-Mir-154-P31 Mmr-Mir-154-P32 Mmr-Mir-154-P33 Mmr-Mir-154-P34 Mmr-Mir-154-P37 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Bta-Mir-154-P30 Cfa-Mir-154-P30 Cja-Mir-154-P30 Cpo-Mir-154-P30 Dno-Mir-154-P30 Eca-Mir-154-P30 Ete-Mir-154-P30 Hsa-Mir-154-P30 Laf-Mir-154-P30 Mml-Mir-154-P30 Mmu-Mir-154-P30 Ocu-Mir-154-P30 Pab-Mir-154-P30 Rno-Mir-154-P30 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Eutheria | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_000165445.3_Mmur_3.0_genomic) |
CM007663.1: 12759249-12759302 [+] UCSC Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-154-P30) |
Mir-154-P1
CM007663.1: 12718303-12718361 [+]
UCSC
Ensembl
Mir-154-P2-v2 CM007663.1: 12719569-12719626 [+] UCSC Ensembl Mir-154-P2-v1 CM007663.1: 12719570-12719625 [+] UCSC Ensembl Mir-154-P3-v1 CM007663.1: 12720026-12720080 [+] UCSC Ensembl Mir-154-P3-v2 CM007663.1: 12720027-12720079 [+] UCSC Ensembl Mir-154-P37 CM007663.1: 12721366-12721423 [+] UCSC Ensembl Mir-154-P5 CM007663.1: 12721763-12721818 [+] UCSC Ensembl Mir-154-P6a-v1 CM007663.1: 12721925-12721980 [+] UCSC Ensembl Mir-154-P6a-v2 CM007663.1: 12721925-12721980 [+] UCSC Ensembl Mir-154-P7 CM007663.1: 12722219-12722276 [+] UCSC Ensembl Mir-154-P8a CM007663.1: 12722967-12723025 [+] UCSC Ensembl Mir-154-P8b CM007663.1: 12723284-12723341 [+] UCSC Ensembl Mir-154-P9 CM007663.1: 12725475-12725530 [+] UCSC Ensembl Mir-154-P10 CM007663.1: 12725895-12725951 [+] UCSC Ensembl Mir-154-P11 CM007663.1: 12727838-12727894 [+] UCSC Ensembl Mir-154-P12 CM007663.1: 12729563-12729620 [+] UCSC Ensembl Mir-376-P1 CM007663.1: 12733939-12733996 [+] UCSC Ensembl Mir-376-P2 CM007663.1: 12734266-12734323 [+] UCSC Ensembl Mir-376-P3 CM007663.1: 12734651-12734708 [+] UCSC Ensembl Mir-154-P14 CM007663.1: 12734778-12734832 [+] UCSC Ensembl Mir-376-P4 CM007663.1: 12735002-12735059 [+] UCSC Ensembl Mir-376-P5 CM007663.1: 12735323-12735380 [+] UCSC Ensembl Mir-154-P16 CM007663.1: 12737194-12737253 [+] UCSC Ensembl Novel-1 CM007663.1: 12738931-12738989 [+] UCSC Ensembl Mir-154-P17 CM007663.1: 12739835-12739897 [+] UCSC Ensembl Mir-154-P18 CM007663.1: 12740364-12740421 [+] UCSC Ensembl Mir-154-P20 CM007663.1: 12741825-12741884 [+] UCSC Ensembl Mir-544 CM007663.1: 12742576-12742632 [+] UCSC Ensembl Mir-154-P21 CM007663.1: 12743455-12743514 [+] UCSC Ensembl Mir-154-P22 CM007663.1: 12745610-12745663 [+] UCSC Ensembl Mir-154-P23 CM007663.1: 12746050-12746107 [+] UCSC Ensembl Mir-154-P24 CM007663.1: 12748064-12748121 [+] UCSC Ensembl Mir-134 CM007663.1: 12748440-12748499 [+] UCSC Ensembl Mir-154-P25 CM007663.1: 12749203-12749261 [+] UCSC Ensembl Mir-154-P6b CM007663.1: 12750026-12750082 [+] UCSC Ensembl Mir-154-P26 CM007663.1: 12753864-12753921 [+] UCSC Ensembl Mir-154-P28 CM007663.1: 12755051-12755104 [+] UCSC Ensembl Mir-154-P29 CM007663.1: 12756506-12756565 [+] UCSC Ensembl Mir-541 CM007663.1: 12758520-12758585 [+] UCSC Ensembl Mir-154-P30 CM007663.1: 12759249-12759302 [+] UCSC Ensembl Mir-154-P31 CM007663.1: 12759397-12759451 [+] UCSC Ensembl Mir-154-P32 CM007663.1: 12759536-12759591 [+] UCSC Ensembl Mir-154-P33 CM007663.1: 12759838-12759893 [+] UCSC Ensembl Mir-154-P6c CM007663.1: 12760342-12760397 [+] UCSC Ensembl Mir-154-P34 CM007663.1: 12760563-12760618 [+] UCSC Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AAUGUUG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
AGUCCGCGCCUCUCCAUGGUACUCGGGGAGAGGUUACCCGAGCAACUUUGCAUCUGGACGACGAAUGUUGCUCGGUGAACCCCUCUUCGGUAUCAAAUUCCACCAGGGAGGCGUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 AGUCCGCGCCUCUCCAU---| U A AC - CA UG GGUAC CGGGGAG GGUU CCGAGCAAC UUUG UC \ CUAUG GCUUCUC CCAA GGCUCGUUG AAGC AG G UGCGGAGGGACCACCUUAAA^ - C GU U -- CA 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | This gene was classified as a non-canonical miRNA in Fromm et al. (2015) given that the Dicer cut is consistently +4. However, the Drosha cut is +2 and reads are abrogated with the Drosha knock-out and hence it is accepted here. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | UG at 5p(-14), CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Mmr-Mir-154-P30_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- AGGUUACCCGAGCAACUUUGCAUC -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Mmr-Mir-154-P30_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | MIMAT0049190 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
32- GAAUGUUGCUCGGUGAACCCCU -54
Get sequence
|