MirGeneDB

MirGeneDB ID

Lgi-Mir-1986

Family name MIR-1986 (all species)
Seed GGAUUUC
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-1986
Paralogues
Orthologues Cgi-Mir-1986  Cte-Mir-1986  Lan-Mir-1986 
Node of Origin (locus) Lophotrochozoa
Node of Origin (family) Lophotrochozoa
Genome context
(Lotgi1)
LOTGIsca_39: 81755-81811 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-1986)
Mir-1986 LOTGIsca_39: 81755-81811 [-] Ensembl
Mir-1990 LOTGIsca_39: 82026-82079 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUUCGAGAGAAUUUCACCGGCUAUUGUGGGCGCGGAUCGUGGGGGCACCACUCUUACUUUCACGGUGGAUUUCCCAAGAUCCGUGAUUGCAGUUCAGUUGGUAUCGACAGGCAGCUG
Get precursor sequence
Structure
        10        20          30        40        50        
UUUCGAGAGAAUUUCACC    --|   UG G        G      CA     CUUAC 
                  GGCU  AUUG  G CGCGGAUC UGGGGG  CCACU     \
                  UUGA  UGAC  U GUGCCUAG ACCCUU  GGUGG     U
GUCGACGGACAGCUAUGG    CU^   GU A        A      UA     CACUU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-1986_5p* (predicted)

MirBase accessionNone
Sequence
0- CGCGGAUCGUGGGGGCACCACU -22
Get sequence
Mature sequence

Lgi-Mir-1986_3p

MirBase accessionMIMAT0009728
Sequence
35- UGGAUUUCCCAAGAUCCGUGAU -57
Get sequence