MirGeneDB

MirGeneDB ID

Isc-Mir-76

Family name MIR-76 (all species)
Seed UCGUUGU
Species Deer tick (Ixodes scapularis)
MiRBase ID
Paralogues
Orthologues Aae-Mir-76  Asu-Mir-76  Bge-Mir-76  Cbr-Mir-76  Cel-Mir-76  Cgi-Mir-76  Cte-Mir-76  Dan-Mir-76  Dme-Mir-76  Dmo-Mir-76  Dpu-Mir-76  Efe-Mir-76  Hme-Mir-76  Lan-Mir-76-P1  Lan-Mir-76-P2  Lgi-Mir-76  Pmi-Mir-76  Spu-Mir-76  Tca-Mir-76 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
DS732844: 119430-119510 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AACAAAGAUAAGAUAUUCCGCCACGCCUGUCAGGUCUCUCGACCAACGACCAGAGUCUCUGGAAAGGAUGACCGGGAACCGGUCAACUGUUCGUUGUCGUAGAAACCUGAUAGGAGUGCGUCGGGCUCUCGUCGGUGUGGU
Get precursor sequence
Structure
        10        20          30         40        50        60          
AACAAAGAUAAGAUAUUC  - -   G          C   -|   C     C  GAGUCUCUGGAAAGGAU 
                  CG C CAC CCUGUCAGGU UCU CGAC AACGA CA                 \
                  GC G GUG GGAUAGUCCA AGA GCUG UUGCU GU                 G
UGGUGUGGCUGCUCUCGG  U C   A          A   U^   -     U  CAACUGGCCAAGGGCCA 
 .       130       120       110       100         90        80
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Star sequence

Isc-Mir-76_5p*

MirBase accessionNone
Sequence
0- CAGGUCUCUCGACCAACGACCA -22
Get sequence
Mature sequence

Isc-Mir-76_3p

MirBase accessionNone
Sequence
59- UUCGUUGUCGUAGAAACCUGAU -81
Get sequence