MirGeneDB

MirGeneDB ID

Lgi-Mir-76

Family name MIR-76 (all species)
Seed UCGUUGU
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-981
Paralogues
Orthologues Aae-Mir-76  Asu-Mir-76  Bge-Mir-76  Cbr-Mir-76  Cel-Mir-76  Cgi-Mir-76  Cte-Mir-76  Dan-Mir-76  Dme-Mir-76  Dmo-Mir-76  Dpu-Mir-76  Efe-Mir-76  Hme-Mir-76  Isc-Mir-76  Lan-Mir-76-P1  Lan-Mir-76-P2  Pmi-Mir-76  Spu-Mir-76  Tca-Mir-76 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_42: 846613-846673 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUUGUUAAGAAGAGAUAUUCAGACAUUUUGACGGGUUUCGCGAUUUGCGAACAGUCUAACGGAUUGUGUUCGUUGUCGACGAAACCUGCCUUAAGCCCCUGAUCAUCCUGCAAUGGUACAA
Get precursor sequence
Structure
        10         20        30          40         50          
UUUGUUAAGAAGAGAUAU-    ACAU     --         -|   UU       GUCUAA 
                   UCAG    UUUGA  CGGGUUUCG CGAU  GCGAACA      \
                   AGUC    GAAUU  GUCCAAAGC GCUG  UGCUUGU      C
AACAUGGUAACGUCCUACU    CCC-     CC         A^   U-       GUUAGG 
 .       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-76_5p* (predicted)

MirBase accessionNone
Sequence
0- ACGGGUUUCGCGAUUUGCGAACA -23
Get sequence
Mature sequence

Lgi-Mir-76_3p

MirBase accessionMIMAT0009601
Sequence
38- UUCGUUGUCGACGAAACCUGCCU -61
Get sequence