MirGeneDB

MirGeneDB ID

Gga-Mir-1677-P6

Family name MIR-1677 (all species)
Seed UGACUUA
Species Chicken (Gallus gallus)
MiRBase ID
Paralogues Gga-Mir-1677-P1  Gga-Mir-1677-P2  Gga-Mir-1677-P3  Gga-Mir-1677-P4  Gga-Mir-1677-P5 
Orthologues Cli-Mir-1677-P6  Cpi-Mir-1677-o6  Tgu-Mir-1677-P6 
Node of Origin (locus) Neognathae
Node of Origin (family) Diapsida
Genome context
(galGal5)
2: 83896085-83896142 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAGCCUUGAAUAUUAGCCUUUGGGAUGCAAACCUUCUCCCAUUUAAGUCAAUGUGAGUUUUAUCAUUGACUUAAUUGGAAGUGAGAUUGAGCCACUGGGCAUGUGAGUGGCUUUGUGU
Get precursor sequence
Structure
        10           20        30         40        50        
AAGCCUUGAAUAUUAGC---| UUG  AUG   AC   -  C   U           UGAG 
                    CU   GG   CAA  CUU CU CCA UUAAGUCAAUG    U
                    GG   CC   GUU  GAG GA GGU AAUUCAGUUAC    U
UGUGUUUCGGUGAGUGUACG^ UCA  GA-   A-   U  A   U           UAUU 
      110       100        90          80        70        60
Deep sequencing
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-1677-P6_5p* (predicted)

MirBase accessionNone
Sequence
0- ACCUUCUCCCAUUUAAGUCAAUG -23
Get sequence
Mature sequence

Gga-Mir-1677-P6_3p (predicted)

MirBase accessionNone
Sequence
35- UUGACUUAAUUGGAAGUGAGAUU -58
Get sequence