MirGeneDB

MirGeneDB ID

Dme-Mir-962

Family name MIR-962 (all species)
Seed UAAGGUA
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-962
Paralogues
Orthologues Dan-Mir-962  Dmo-Mir-962 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(dm6)
chr2L: 5641315-5641374 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-962)
Mir-959-v1 chr2L: 5640958-5641021 [+] UCSC Ensembl
Mir-959-v2 chr2L: 5640959-5641020 [+] UCSC Ensembl
Mir-960 chr2L: 5641081-5641140 [+] UCSC Ensembl
Mir-961 chr2L: 5641208-5641266 [+] UCSC Ensembl
Mir-962 chr2L: 5641315-5641374 [+] UCSC Ensembl
Mir-963 chr2L: 5642005-5642064 [+] UCSC Ensembl
Mir-964-v1 chr2L: 5642127-5642187 [+] UCSC Ensembl
Mir-964-v2 chr2L: 5642128-5642186 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUUCAACUACUUCGAUGGGGCACUCAGGCUAUAAGGUAGAGAAAUUGAUGCUGUCUACACUAUUCAGACUUCAGUUUCAUUACCUUUCAAUUUGUUUGCCCCCAUGCAACAGUGAUAGUA
Get precursor sequence
Structure
        10          20        30        40        50          
AUUCAACUACUUCGAUG--     CU    CUAU       A        UG-|  UCUAC 
                   GGGCA  CAGG    AAGGUAG GAAAUUGA   CUG     \
                   CCCGU  GUUU    UUCCAUU CUUUGACU   GAC     A
AUGAUAGUGACAACGUACC     UU    AACU       A        UCA^  UUAUC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Mature sequence

Dme-Mir-962_5p

MirBase accessionMIMAT0005476
Sequence
0- AUAAGGUAGAGAAAUUGAUGCUGUCU -26
Get sequence
Validated targets microrna.org: MIMAT0005476
TargetScanFly: dme-miR-962
Star sequence

Dme-Mir-962_3p*

MirBase accessionMIMAT0020857
Sequence
37- ACUUCAGUUUCAUUACCUUUCAA -60
Get sequence