MirGeneDB

MirGeneDB ID

Dme-Mir-964-v2

Family name MIR-964 (all species)
Seed AGAAUAG
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-964
Paralogues Dme-Mir-964-v1 
Orthologues Dan-Mir-964  Dmo-Mir-964 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(dm6)
chr2L: 5642128-5642186 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-964-v2)
Mir-959-v1 chr2L: 5640958-5641021 [+] UCSC Ensembl
Mir-959-v2 chr2L: 5640959-5641020 [+] UCSC Ensembl
Mir-960 chr2L: 5641081-5641140 [+] UCSC Ensembl
Mir-961 chr2L: 5641208-5641266 [+] UCSC Ensembl
Mir-962 chr2L: 5641315-5641374 [+] UCSC Ensembl
Mir-963 chr2L: 5642005-5642064 [+] UCSC Ensembl
Mir-964-v1 chr2L: 5642127-5642187 [+] UCSC Ensembl
Mir-964-v2 chr2L: 5642128-5642186 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUACCAAUAACAUAUUGGUCCAACUUGCCUUAGAAUAGGGGAGCUUAACUUAUGUUUUUGAUGUUUAAGUUAAAAGCCUCUGUUCUAAGACAAUUUGAUGAUCAAAACAGCCGGAGAAA
Get precursor sequence
Structure
        10        20          30        40        50         
AUACCAAUAACAUAUUGGUC--|  C   C             AGC        UGUUUU 
                      CAA UUG CUUAGAAUAGGGG   UUAACUUA      \
                      GUU AAC GAAUCUUGUCUCC   AAUUGAAU      U
AAAGAGGCCGACAAAACUAGUA^  U   A             GAA        UUGUAG 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Mature sequence

Dme-Mir-964-v2_5p

MirBase accessionMIMAT0005478
Sequence
0- UAGAAUAGGGGAGCUUAACUUA -22
Get sequence
Validated targets microrna.org: MIMAT0005478
TargetScanFly: dme-miR-964
Star sequence

Dme-Mir-964-v2_3p*

MirBase accessionMIMAT0020859
Sequence
37- AGUUAAAAGCCUCUGUUCUAAG -59
Get sequence