MirGeneDB

MirGeneDB ID

Dme-Mir-961

Family name MIR-961 (all species)
Seed UUGAUCA
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-mir-961
Paralogues
Orthologues Dan-Mir-961 
Node of Origin (locus) Drosophila melanogaster group
Node of Origin (family) Drosophila melanogaster group
Genome context
(dm6)
chr2L: 5641208-5641266 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-961)
Mir-959-v1 chr2L: 5640958-5641021 [+] UCSC Ensembl
Mir-959-v2 chr2L: 5640959-5641020 [+] UCSC Ensembl
Mir-960 chr2L: 5641081-5641140 [+] UCSC Ensembl
Mir-961 chr2L: 5641208-5641266 [+] UCSC Ensembl
Mir-962 chr2L: 5641315-5641374 [+] UCSC Ensembl
Mir-963 chr2L: 5642005-5642064 [+] UCSC Ensembl
Mir-964-v1 chr2L: 5642127-5642187 [+] UCSC Ensembl
Mir-964-v2 chr2L: 5642128-5642186 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGUGAGCUCGUUAUCAAGGGCCGAGUUACCUUUGAUCACCAGUAACUGAGAUUGUUUCUGAUACGGUUUCGUUUUCUGGCAAUCAAAAGAACUUGGACUCGACUUGAAUUCAACUACUU
Get precursor sequence
Structure
        10          20         30        40         50         
AGUGAGCUCGUUAUCAA--   -|      ACC      CA    U-   U     UGUUUC 
                   GGG CCGAGUU   UUUGAU  CCAG  AAC GAGAU      \
                   CUC GGUUCAA   AAACUA  GGUC  UUG CUUUG      U
UUCAUCAACUUAAGUUCAG   A^      GA-      AC    UU   -     GCAUAG 
       110       100        90         80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Mature sequence

Dme-Mir-961_5p

MirBase accessionMIMAT0005475
Sequence
0- UUUGAUCACCAGUAACUGAGAU -22
Get sequence
Validated targets microrna.org: MIMAT0005475
TargetScanFly: dme-miR-961
Star sequence

Dme-Mir-961_3p*

MirBase accessionMIMAT0020856
Sequence
37- UUCGUUUUCUGGCAAUCAAAAG -59
Get sequence