MirGeneDB

MirGeneDB ID

Dmo-Mir-964

Family name MIR-964 (all species)
Seed UAGAAUA
Species Fruit fly (Drosophila mojavensis)
MiRBase ID
Paralogues
Orthologues Dan-Mir-964  Dme-Mir-964-v1  Dme-Mir-964-v2 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dmoj_caf1)
scaffold_6500: 14019536-14019594 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUGUGAUGAAAUCAUUGAGUUCAACUUAUCUUAGAAUAGGGGAGCUUAACUUAAUCUGAACACUCAAGCUAAGAGCCUCGAUUCUUCGAUAAUGCGACUAACAGCAACUAAUUUAACUG
Get precursor sequence
Structure
        10           20         30        40        50         
UUGUGAUGAAAUCAUUG---    -| AC     UU     A    AG    A   AAUCUG 
                    AGUU CA  UUAUC  AGAAU GGGG  CUUA CUU      \
                    UCAG GU  AAUAG  UCUUA CUCC  GAAU GAA      A
GUCAAUUUAAUCAACGACAA    C^ --     CU     G    GA    C   CUCACA 
       110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-964_5p

MirBase accessionNone
Sequence
0- UUAGAAUAGGGGAGCUUAACUU -22
Get sequence
Star sequence

Dmo-Mir-964_3p*

MirBase accessionNone
Sequence
37- GCUAAGAGCCUCGAUUCUUCGA -59
Get sequence