MirGeneDB

MirGeneDB ID

Dan-Mir-962

Family name MIR-962 (all species)
Seed UAAGGUA
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Dme-Mir-962  Dmo-Mir-962 
Node of Origin (locus) Drosophila
Node of Origin (family) Drosophila
Genome context
(Dana_caf1)
scaffold_12916: 11085121-11085180 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CCCAACCACCUGGCCGAGGGCACUCAAGCUAUAAGGUAGAGAAAAUAAUGUCUUCGUCUCCAAAUAGACAUCAAUUUCCCUAGCUUGCAUUUUGCCUGCCCCCAAGCAACAAUGAUAACA
Get precursor sequence
Structure
        10          20        30        40        50         
CCCAACCACCUGGCCGA--|    CU    CUA    G   A    AUA      UCGUC 
                   GGGCA  CAAG   UAAG UAG GAAA   AUGUCU     U
                   CCCGU  GUUU   GUUC AUC CUUU   UACAGA     C
ACAAUAGUAACAACGAACC^    CC    UAC    G   C    AAC      UAAAC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-962_5p

MirBase accessionNone
Sequence
0- AUAAGGUAGAGAAAAUAAUGUCU -23
Get sequence
Star sequence

Dan-Mir-962_3p*

MirBase accessionNone
Sequence
38- CAUCAAUUUCCCUAGCUUGCAU -60
Get sequence