MirGeneDB

MirGeneDB ID

Dan-Mir-965

Family name MIR-965 (all species)
Seed AAGCGUA
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues Aae-Mir-965  Bge-Mir-965  Dme-Mir-965  Dmo-Mir-965  Dpu-Mir-965  Hme-Mir-965  Tca-Mir-965 
Node of Origin (locus) Pancrustacea
Node of Origin (family) Pancrustacea
Genome context
(Dana_caf1)
scaffold_12943: 4147981-4148044 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUGGGUUUUCUGGAAGCUCAACCCUUUUGGGGGGUCAAACUGUACGUUCUAUGUGGCAAUCUUAGAAAUUCAUAAGCGUAUAGCUUUUCCCCUUAAAAGUUGAAGCAAAGUCAACAAAUCUCAA
Get precursor sequence
Structure
        10            20        30        40        50        60  
AUGGGUUUUCUGGAAGC----|    CC          UC  A         C    UGGCAAUC 
                     UCAAC  UUUUGGGGGG  AA CUGUACGUU UAUG        \
                     AGUUG  AAAAUUCCCC  UU GAUAUGCGA AUAC        U
AACUCUAAACAACUGAAACGA^    --          UU  C         -    UUAAAGAU 
  120       110       100          90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Star sequence

Dan-Mir-965_5p*

MirBase accessionNone
Sequence
0- GGGGUCAAACUGUACGUUCUAUG -23
Get sequence
Mature sequence

Dan-Mir-965_3p

MirBase accessionNone
Sequence
42- UAAGCGUAUAGCUUUUCCCCUU -64
Get sequence