MirGeneDB

MirGeneDB ID

Cpo-Mir-450-P2

Family name MIR-450 (all species)
Seed UUUGCGA
Species Guinea pig (Cavia porcellus)
MiRBase ID cpo-mir-450a-2
Paralogues Cpo-Mir-450-P1  Cpo-Mir-450-P3 
Orthologues Bta-Mir-450-P2  Cfa-Mir-450-P2  Dno-Mir-450-P2  Hsa-Mir-450-P2  Mml-Mir-450-P2  Mmu-Mir-450-P2  Ocu-Mir-450-P2  Rno-Mir-450-P2a  Rno-Mir-450-P2b 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(cavPor3)
scaffold_128: 2873272-2873328 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-450-P2)
Mir-450-P3 scaffold_128: 2872948-2873006 [-] UCSC
Mir-450-P1 scaffold_128: 2873103-2873159 [-] UCSC
Mir-450-P2 scaffold_128: 2873272-2873328 [-] UCSC
Mir-542 scaffold_128: 2874159-2874217 [-] UCSC
Mir-15-P2d scaffold_128: 2878959-2879021 [-] UCSC
Mir-15-P1d scaffold_128: 2879319-2879377 [-] UCSC
Precursor
(pre-Mir +30nt flank)
AAAAACAAAGAAAAAAUGAUGCUAAACUAUUUUUGCGAUGUGUUCCUAAUAUGUAAUAUGAAUGUAUUGGGAACAUUUUGCAUUCAUAGUUUUGUGUCAAUAAUAUGCAGAAAGGCC
Get precursor sequence
Structure
        10          20        30        40        50        
AAAAACAAAGAAAAAAU--|    U       UUU     U             GUAAU 
                   GAUGC AAACUAU   UGCGA GUGUUCCUAAUAU     \
                   CUGUG UUUGAUA   ACGUU UACAAGGGUUAUG     A
CCGGAAAGACGUAUAAUAA^    U       CUU     U             UAAGU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Mature sequence

Cpo-Mir-450-P2_5p

MirBase accessionMIMAT0047261
Sequence
0- UUUUGCGAUGUGUUCCUAAUAU -22
Get sequence
Star sequence

Cpo-Mir-450-P2_3p*

MirBase accessionMIMAT0047263
Sequence
35- AUUGGGAACAUUUUGCAUUCAU -57
Get sequence