MirGeneDB

MirGeneDB ID

Bta-Mir-127

Family name MIR-127 (all species)
Seed CGGAUCC
Species Cow (Bos taurus)
MiRBase ID bta-mir-127
Paralogues
Orthologues Cfa-Mir-127  Cpo-Mir-127  Dno-Mir-127  Ete-Mir-127  Hsa-Mir-127  Mml-Mir-127  Mmu-Mir-127  Ocu-Mir-127  Rno-Mir-127 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(bosTau8)
chr21: 67429764-67429819 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-127)
Mir-431 chr21: 67427789-67427853 [+] UCSC Ensembl
Mir-433 chr21: 67428660-67428733 [+] UCSC Ensembl
Mir-127 chr21: 67429764-67429819 [+] UCSC Ensembl
Mir-432 chr21: 67431250-67431318 [+] UCSC Ensembl
Mir-136-v1 chr21: 67431437-67431492 [+] UCSC Ensembl
Mir-136-v2 chr21: 67431437-67431492 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUCCUCGCUUUGAUCACUGUCUCCAGCCUGCUGAAGCUCAGAGGGCUCUGAUUCAGAAAGAUCAUCGGAUCCGUCUGAGCUUGGCUGGUCGGAAGUCUCCUCAUCUGCUUCCUUCG
Get precursor sequence
Structure
        10        20          30        40        50        
CUCCUCGCUUUGAUCACUGUC--|  A   U   G         G  C      UCAGA 
                       UCC GCC GCU AAGCUCAGA GG UCUGAU     \
                       AGG UGG CGG UUCGAGUCU CC AGGCUA     A
GCUUCCUUCGUCUACUCCUCUGA^  C   U   -         G  U      CUAGA 
    110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-127_5p*

MirBase accessionNone
Sequence
0- CUGAAGCUCAGAGGGCUCUGAUU -23
Get sequence
Mature sequence

Bta-Mir-127_3p

MirBase accessionMIMAT0003787
Sequence
34- UCGGAUCCGUCUGAGCUUGGCU -56
Get sequence
Validated targets TargetScanVert: bta-miR-127