MirGeneDB

MirGeneDB ID

Bge-Mir-279-o39

Family name MIR-279 (all species)
Seed GACUAGA
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues Bge-Mir-279-o35  Bge-Mir-279-o36  Bge-Mir-279-o37  Bge-Mir-279-o38 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) B. germanica
Node of Origin (family) Protostomia
Genome context
(Bger_2.0)
KZ615200.1: 181846-181905 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AUCUAGUUGGCAGUGAUACUUCUUGUGGUGGAUGGGUGUAUCUCUAGUGCAUGUUUUUUUAUAUCUCAUGACUAGAUUUUCACUCGUUCAUCAAGAGAUUUAAAUCGGCAACCACUUCAU
Get precursor sequence
Structure
        10        20          30        40        50          
AUCUAGUUGGCAGUGAUACU--|   G             UAUC      G    UUUUUU 
                      UCUU UGGUGGAUGGGUG    UCUAGU CAUG      \
                      AGAG ACUACUUGCUCAC    AGAUCA GUAC      U
UACUUCACCAACGGCUAAAUUU^   A             UUUU      -    UCUAUA 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Star sequence

Bge-Mir-279-o39_5p*

MirBase accessionNone
Sequence
0- GAUGGGUGUAUCUCUAGUGCAUG -23
Get sequence
Mature sequence

Bge-Mir-279-o39_3p

MirBase accessionNone
Sequence
38- UGACUAGAUUUUCACUCGUUCA -60
Get sequence