MirGeneDB

MirGeneDB ID

Bge-Mir-279-o37

Family name MIR-279 (all species)
Seed GACUAGA
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues Bge-Mir-279-o35  Bge-Mir-279-o36  Bge-Mir-279-o38  Bge-Mir-279-o39 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) B. germanica
Node of Origin (family) Protostomia
Genome context
(Bger_2.0)
KZ614992.1: 536335-536392 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UUGCUUCAUGUGAAACCCUUGGUUUCUGUAGGCGGGUCUGGGUCUGGAUUACGCAAUUUUAAGACGUGACUAGAUCCAUACUCGUCUAUAAUAAUCAGGAAGAUCGGCUUAUGAUUUU
Get precursor sequence
Structure
        10          20        30        40        50         
UUGCUUCAUGUGAAACC--|      UC           C         A     CAAUU 
                   CUUGGUU  UGUAGGCGGGU UGGGUCUGG UUACG     \
                   GGACUAA  AUAUCUGCUCA ACCUAGAUC AGUGC     U
UUUUAGUAUUCGGCUAGAA^      UA           U         -     AGAAU 
      110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Star sequence

Bge-Mir-279-o37_5p*

MirBase accessionNone
Sequence
0- GGCGGGUCUGGGUCUGGAUUACG -23
Get sequence
Mature sequence

Bge-Mir-279-o37_3p

MirBase accessionNone
Sequence
36- UGACUAGAUCCAUACUCGUCUA -58
Get sequence