MirGeneDB

MirGeneDB ID

Bge-Mir-279-o35

Family name MIR-279 (all species)
Seed GACUAGA
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues Bge-Mir-279-o36  Bge-Mir-279-o37  Bge-Mir-279-o38  Bge-Mir-279-o39 
Orthologues Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) B. germanica
Node of Origin (family) Protostomia
Genome context
(Bger_2.0)
KZ614498.1: 736091-736150 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AGAAAGACAUCAUGUGGGACUACCUCAGGUGACGGAUGUUGCUCUGGUGCACGUUAUAUGAAUAGUCGUGACUAGAGUGACACUCGUCGACUGAGGAAGUCAUUUUCAUCUGUGGUUAAA
Get precursor sequence
Structure
        10          20        30        40        50          
AGAAAGACAUCAUGUGG--|   A      G     GA   UG       G    UUAUAU 
                   GACU CCUCAG UGACG  UGU  CUCUGGU CACG      \
                   CUGA GGAGUC GCUGC  ACA  GAGAUCA GUGC      G
AAAUUGGUGUCUACUUUUA^   A      A     UC   GU       -    UGAUAA 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Star sequence

Bge-Mir-279-o35_5p*

MirBase accessionNone
Sequence
0- GACGGAUGUUGCUCUGGUGCACG -23
Get sequence
Mature sequence

Bge-Mir-279-o35_3p

MirBase accessionNone
Sequence
38- UGACUAGAGUGACACUCGUCGA -60
Get sequence