MirGeneDB

MirGeneDB ID

Aae-Mir-210-v2

Family name MIR-210 (all species)
Seed UUGUGCG
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-210
Paralogues Aae-Mir-210-v1 
Orthologues Aca-Mir-210  Ami-Mir-210  Bfl-Mir-210  Bge-Mir-210-v2  Bta-Mir-210  Cfa-Mir-210  Cgi-Mir-210  Cli-Mir-210  Cpi-Mir-210  Cpo-Mir-210  Dan-Mir-210-v2  Dme-Mir-210-v2  Dmo-Mir-210-v2  Dno-Mir-210  Dpu-Mir-210  Dre-Mir-210  Efe-Mir-210  Ete-Mir-210  Gga-Mir-210  Hsa-Mir-210  Isc-Mir-210  Lan-Mir-210  Lgi-Mir-210  Mdo-Mir-210  Mml-Mir-210  Mmu-Mir-210  Oan-Mir-210  Ocu-Mir-210  Pfl-Mir-210  Pmi-Mir-210  Rno-Mir-210  Sha-Mir-210  Sko-Mir-210  Spu-Mir-210-v2  Tca-Mir-210-v2  Tgu-Mir-210  Xtr-Mir-210 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Aaeg_L3)
supercont1.512: 515646-515703 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-210-v2)
Mir-210-v1 supercont1.512: 515646-515703 [-] Ensembl
Mir-210-v2 supercont1.512: 515646-515703 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UCCCGAAAUCAACCGUGUGAAUCUCAUUGCAGCUGCUGACCACUGCACAAGAUUAGAUUAUGACUCUUGUGCGUGUGACAACGGCUAUUGUGGGCAUUCCGAGUCAUCCAAGGAAAAA
Get precursor sequence
Structure
        10         20         30        40         50        
UCCCGAAAUCAACCGUGU-    -|    UGC     C  AC   -         UUAGA 
                   GAAU CUCAU   AGCUG UG  CAC UGCACAAGA     U
                   CUUA GGGUG   UCGGC AC  GUG GCGUGUUCU     U
AAAAAGGAACCUACUGAGC    C^    UUA     A  A-   U         CAGUA 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe To To To
Star sequence

Aae-Mir-210-v2_5p*

MirBase accessionNone
Sequence
0- AGCUGCUGACCACUGCACAAGAU -23
Get sequence
Mature sequence

Aae-Mir-210-v2_3p

MirBase accessionMIMAT0014293
Sequence
35- CUUGUGCGUGUGACAACGGCUAU -58
Get sequence