MirGeneDB

MirGeneDB ID

Rno-Mir-448

Family name MIR-448 (all species)
Seed UGCAUAU
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-448
Paralogues
Orthologues Bta-Mir-448  Cfa-Mir-448  Cpo-Mir-448  Ete-Mir-448  Hsa-Mir-448  Mml-Mir-448  Mmu-Mir-448  Ocu-Mir-448 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chrX: 118277695-118277774 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAGUUGACCUUCACAUGGACGGGGAGGUUGAACAUCCUGCAUAGUGCUGCCAGGAAAUCCCUACUUCAUACUAAGAGGGGGCUGGCUGGUUGCAUAUGUAGGAUGUCCCAUCUCCCGGCCCACUUCGUCAUGACAGAUA
Get precursor sequence
Structure
        10         20         30        40        50        60        70
GCAGUUGACCUUCACAU-  A-|   G    UGA            G   U   AGGAAAUCCCUACUUCA 
                  GG  CGGG AGGU   ACAUCCUGCAUA UGC GCC                 U
                  CC  GCCC UCUA   UGUAGGAUGUAU ACG UGG                 A
AUAGACAGUACUGCUUCA  CG^   -    CCC            -   U   UCGGUCGGGGGAGAAUC 
.       130       120        110       100         90        80
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Star sequence

Rno-Mir-448_5p*

MirBase accessionMIMAT0017177
Sequence
0- GAACAUCCUGCAUAGUGCUGCC -22
Get sequence
Validated targets TargetScanVert: rno-miR-448-5p
miRDB: MIMAT0017177
Mature sequence

Rno-Mir-448_3p

MirBase accessionMIMAT0001534
Sequence
60- UUGCAUAUGUAGGAUGUCCC -80
Get sequence
Validated targets microrna.org: MIMAT0001534
TargetScanVert: rno-miR-448-3p
miRDB: MIMAT0001534