MirGeneDB

MirGeneDB ID

Rno-Mir-185

Family name MIR-185 (all species)
Seed GGAGAGA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-185
Paralogues
Orthologues Bta-Mir-185  Cfa-Mir-185  Cpo-Mir-185  Dno-Mir-185  Ete-Mir-185  Hsa-Mir-185  Mml-Mir-185  Mmu-Mir-185  Ocu-Mir-185 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(rn6)
chr11: 86812715-86812769 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGGGCCUGGCUUGAGUGGGGGGUGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCAGGGGCUGGCUUUCCUCUGGUCCUUCUCUCCCAAUAACUGCGUCUUCAUCG
Get precursor sequence
Structure
        10          20        30        40        50       
CGGGCCUGGCUUGAGUG--|    U       UG   A     G         AUGGU 
                   GGGGG GAGGGAU  GAG GAAAG CAGUUCCUG     C
                   CCCUC CUUCCUG  CUC CUUUC GUCGGGGAC     C
GCUACUUCUGCGUCAAUAA^    U       GU   -     G         CCUCC 
   110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-185_5p

MirBase accessionMIMAT0000862
Sequence
0- UGGAGAGAAAGGCAGUUCCUGA -22
Get sequence
Validated targets microrna.org: MIMAT0000862
TargetScanVert: rno-miR-185-5p
miRDB: MIMAT0000862
Star sequence

Rno-Mir-185_3p*

MirBase accessionMIMAT0017142
Sequence
34- AGGGGCUGGCUUUCCUCUGGU -55
Get sequence
Validated targets TargetScanVert: rno-miR-185-3p
miRDB: MIMAT0017142