MirGeneDB

MirGeneDB ID

Bta-Mir-185

Family name MIR-185 (all species)
Seed GGAGAGA
Species Cow (Bos taurus)
MiRBase ID bta-mir-185
Paralogues
Orthologues Cfa-Mir-185  Cpo-Mir-185  Dno-Mir-185  Ete-Mir-185  Hsa-Mir-185  Mml-Mir-185  Mmu-Mir-185  Ocu-Mir-185  Rno-Mir-185 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(bosTau8)
chr17: 74967079-74967134 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGCAGGCCUCCUGAGUGGGGGGUGAGGGACUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCUUUCCUCCGGCCCCUCCUUCCUGAUGACUGCGUCUGCACCA
Get precursor sequence
Structure
        10           20        30        40        50        
AGCAGGCCUCCUGAGUG---|    U     A      A     G         AUGGUC 
                    GGGGG GAGGG CUGGAG GAAAG CAGUUCCUG      \
                    CCUUC CUCCC GGCCUC CUUUC GUCGGGGAC      C
ACCACGUCUGCGUCAGUAGU^    -     C      -     G         CCCUCC 
    110       100         90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-185_5p

MirBase accessionMIMAT0009247
Sequence
0- UGGAGAGAAAGGCAGUUCCUGA -22
Get sequence
Validated targets TargetScanVert: bta-miR-185
Star sequence

Bta-Mir-185_3p*

MirBase accessionNone
Sequence
35- AGGGGCUGGCUUUCCUCCGGC -56
Get sequence