MirGeneDB ID | Ofu-Mir-2-o155 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Tubeworm (Owenia fusiformis) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Ofu-Mir-2-o153 Ofu-Mir-2-o154 Ofu-Mir-2-o156 Ofu-Mir-2-o157 Ofu-Mir-2-o158 Ofu-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | O. fusiformis | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (GCA_903813345.2_Owenia) |
CAIIXF020000003.1: 15960009-15960067 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-2-o155) |
Mir-71
CAIIXF020000003.1: 15950516-15950575 [+]
Mir-2-o153 CAIIXF020000003.1: 15958470-15958526 [+] Mir-2-P12 CAIIXF020000003.1: 15958948-15959009 [+] Mir-2-o154 CAIIXF020000003.1: 15959506-15959565 [+] Mir-2-o155 CAIIXF020000003.1: 15960009-15960067 [+] Mir-2-o156 CAIIXF020000003.1: 15960548-15960608 [+] Mir-2-o157 CAIIXF020000003.1: 15962486-15962544 [+] Mir-2-o158 CAIIXF020000003.1: 15964675-15964734 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
AUGUAAAAUAAGGCAUUAUUCUUCAUGAUACCCAUUAGGUAGAUUUGAUAUGUUUUCUUUUCUCAUAUCACAGCUAGCUUUGAUGGGCUUCAUGUUGAUAUGACAACAGCAUUUUUCUCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 AUGUAAAAUAAGGCAUUAU-- UU UA --| G AUU UUUUC UC CAUGA CCCAUU AG UAG UGAUAUG \ AG GUACU GGGUAG UC AUC ACUAUAC U CUCUUUUUACGACAACAGUAU UU UC UU^ G GAC UCUUU 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Ofu-Mir-2-o155_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- CCCAUUAGGUAGAUUUGAUAUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Ofu-Mir-2-o155_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
35- UAUCACAGCUAGCUUUGAUGGGCU -59
Get sequence
|