| MirGeneDB ID | Obi-Mir-2-o48 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | California two-spot octopus (Octopus bimaculoides) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Obi-Mir-2-o45-v1 Obi-Mir-2-o46-v1 Obi-Mir-2-o47a Obi-Mir-2-o47b Obi-Mir-2-o47c Obi-Mir-2-o47d Obi-Mir-2-o49 Obi-Mir-2-P12 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Esc-Mir-2-o48-v1 Gsp-Mir-2 Npo-Mir-2-o48a Npo-Mir-2-o48b Ovu-Mir-2-o48-v1 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Cephalopoda | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (PRJNA270931_OBI) |
KQ419829: 49651-49710 [-] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-2-o48-v1) |
Mir-2-o49
KQ419829: 49553-49612 [-]
Ensembl
Mir-2-o48-v2 KQ419829: 49651-49710 [-] Ensembl Mir-2-o48-v1 KQ419829: 49651-49710 [-] Ensembl Mir-2-o47d KQ419829: 50094-50153 [-] Ensembl Mir-2-o47c KQ419829: 50292-50351 [-] Ensembl Mir-2-o47b KQ419829: 50497-50556 [-] Ensembl Mir-2-o47a KQ419829: 50806-50865 [-] Ensembl Mir-2-o46-v2 KQ419829: 51011-51070 [-] Ensembl Mir-2-o46-v1 KQ419829: 51011-51070 [-] Ensembl Mir-2-P12 KQ419829: 51162-51227 [-] Ensembl Mir-2-o45-v1 KQ419829: 51363-51423 [-] Ensembl Mir-2-o45-v2 KQ419829: 51363-51423 [-] Ensembl Mir-71 KQ419829: 51632-51690 [-] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Obi-Mir-2-o48-v1 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | CACAGCC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUUGUCGGGGGCUCUGCUCUCUGCUUUAAGUCACCAAAGUGGUGGUGAUGUGUUCUCACUAAACCAUAUCACAGCCAGCUUUGAUGAGCUCAAACAUGAGACCAUACAGCGAUGGCUGGGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GUUGUCGGGGGCUCUGC-- - C A - C -| G UGUUCUC UCUC UG UUU AG UCA CAAAG UGGU GUGAUG A AGAG AC AAA UC AGU GUUUC ACCG CACUAU C GGGUCGGUAGCGACAUACC U - C G A G^ A ACCAAAU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Obi-Mir-2-o48-v1_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UCACCAAAGUGGUGGUGAUG -20
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Obi-Mir-2-o48-v1_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
38- UCACAGCCAGCUUUGAUGAGCU -60
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Variant | Obi-Mir-2-o48-v2 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUUGUCGGGGGCUCUGCUCUCUGCUUUAAGUCACCAAAGUGGUGGUGAUGUGUUCUCACUAAACCAUAUCACAGCCAGCUUUGAUGAGCUCAAACAUGAGACCAUACAGCGAUGGCUGGGGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 GUUGUCGGGGGCUCUGC-- - C A - C -| G UUCUC UCUC UG UUU AG UCA CAAAG UGGU GUGAUGUG A AGAG AC AAA UC AGU GUUUC ACCG CACUAUAC C GGGUCGGUAGCGACAUACC U - C G A G^ A CAAAU . 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Obi-Mir-2-o48-v2_5p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UCACCAAAGUGGUGGUGAUGUG -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Obi-Mir-2-o48-v2_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
36- UAUCACAGCCAGCUUUGAUGAGCU -60
Get sequence
|
