MirGeneDB

MirGeneDB ID

Mmu-Mir-154-P36

Family name MIR-154 (all species)
Seed GGUUACC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-409
Paralogues Mmu-Mir-154-P1  Mmu-Mir-154-P2-v1  Mmu-Mir-154-P2-v2  Mmu-Mir-154-P3a-v1  Mmu-Mir-154-P3a-v2  Mmu-Mir-154-P4  Mmu-Mir-154-P5  Mmu-Mir-154-P6  Mmu-Mir-154-P7  Mmu-Mir-154-P8  Mmu-Mir-154-P9  Mmu-Mir-154-P10  Mmu-Mir-154-P12  Mmu-Mir-154-P13  Mmu-Mir-154-P14  Mmu-Mir-154-P15  Mmu-Mir-154-P17  Mmu-Mir-154-P18  Mmu-Mir-154-P19  Mmu-Mir-154-P20-v1  Mmu-Mir-154-P20-v2  Mmu-Mir-154-P21  Mmu-Mir-154-P22  Mmu-Mir-154-P26  Mmu-Mir-154-P29-v1  Mmu-Mir-154-P29-v2  Mmu-Mir-154-P30  Mmu-Mir-154-P34 
Orthologues Bta-Mir-154-P36  Cfa-Mir-154-P36  Cpo-Mir-154-P36  Dno-Mir-154-P36  Ete-Mir-154-P36  Hsa-Mir-154-P36  Ocu-Mir-154-P36  Rno-Mir-154-P36 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(mm10)
chr12: 109743172-109743225 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P36)
Mir-154-P10 chr12: 109733781-109733838 [+] UCSC Ensembl
Mir-134 chr12: 109734143-109734205 [+] UCSC Ensembl
Mir-154-P15 chr12: 109734910-109734968 [+] UCSC Ensembl
Mir-154-P1 chr12: 109738438-109738495 [+] UCSC Ensembl
Mir-154-P20-v2 chr12: 109739132-109739187 [+] UCSC Ensembl
Mir-154-P20-v1 chr12: 109739132-109739187 [+] UCSC Ensembl
Mir-154-P6 chr12: 109740515-109740574 [+] UCSC Ensembl
Mir-541 chr12: 109742422-109742487 [+] UCSC Ensembl
Mir-154-P36 chr12: 109743172-109743225 [+] UCSC Ensembl
Mir-154-P14 chr12: 109743303-109743358 [+] UCSC Ensembl
Mir-154-P5 chr12: 109743431-109743486 [+] UCSC Ensembl
Mir-154-P12 chr12: 109743729-109743784 [+] UCSC Ensembl
Mir-3072 chr12: 109747893-109747949 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAUCCGAGCCUCUCCGUGGUACUCGGAGAGAGGUUACCCGAGCAACUUUGCAUCUGGAGGACGAAUGUUGCUCGGUGAACCCCUUUUCGGUAUCAAAUCCCUCCAGGGAGGCCA
Get precursor sequence
Structure
        10           20        30        40         50      
CAUCCGAGCCUCUCCGU---|    U       A    AC         -    CAUCU 
                    GGUAC CGGAGAG GGUU  CCGAGCAAC UUUG     \
                    CUAUG GCUUUUC CCAA  GGCUCGUUG AAGC     G
ACCGGAGGGACCUCCCUAAA^    -       C    GU         U    AGGAG 
  110       100        90         80        70        60
Deep sequencing
Go to detailed chart
CommentThis gene was classified as a non-canonical miRNA in Fromm et al. (2015) given that the Dicer cut is consistently +4 but the Drosha cut is +2 and reads are abrogated with the Drosha knock-out and hence it is accepted here.
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-154-P36_5p

MirBase accessionMIMAT0004746
Sequence
0- AGGUUACCCGAGCAACUUUGCAU -23
Get sequence
Validated targets microrna.org: MIMAT0004746
TargetScanVert: mmu-miR-409-5p
miRDB: MIMAT0004746
Co-mature sequence

Mmu-Mir-154-P36_3p

MirBase accessionMIMAT0001090
Sequence
32- GAAUGUUGCUCGGUGAACCCCU -54
Get sequence
Validated targets microrna.org: MIMAT0001090
TargetScanVert: mmu-miR-409-3p
miRDB: MIMAT0001090