MirGeneDB

MirGeneDB ID

Mmu-Mir-154-P21

Family name MIR-154 (all species)
Seed GAGAAAU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-539
Paralogues Mmu-Mir-154-P1  Mmu-Mir-154-P2-v1  Mmu-Mir-154-P2-v2  Mmu-Mir-154-P3a-v1  Mmu-Mir-154-P3a-v2  Mmu-Mir-154-P4  Mmu-Mir-154-P5  Mmu-Mir-154-P6  Mmu-Mir-154-P7  Mmu-Mir-154-P8  Mmu-Mir-154-P9  Mmu-Mir-154-P10  Mmu-Mir-154-P12  Mmu-Mir-154-P13  Mmu-Mir-154-P14  Mmu-Mir-154-P15  Mmu-Mir-154-P17  Mmu-Mir-154-P18  Mmu-Mir-154-P19  Mmu-Mir-154-P20-v1  Mmu-Mir-154-P20-v2  Mmu-Mir-154-P22  Mmu-Mir-154-P26  Mmu-Mir-154-P29-v1  Mmu-Mir-154-P29-v2  Mmu-Mir-154-P30  Mmu-Mir-154-P34  Mmu-Mir-154-P36 
Orthologues Bta-Mir-154-P21  Cfa-Mir-154-P21  Cpo-Mir-154-P21  Dno-Mir-154-P21  Ete-Mir-154-P21  Hsa-Mir-154-P21  Mml-Mir-154-P21  Ocu-Mir-154-P21  Rno-Mir-154-P21 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(mm10)
chr12: 109728136-109728197 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P21)
Mir-154-P19 chr12: 109718757-109718816 [+] UCSC Ensembl
Mir-667 chr12: 109720020-109720083 [+] UCSC Ensembl
Mir-376-P4 chr12: 109722733-109722790 [+] UCSC Ensembl
Mir-376-P3 chr12: 109723471-109723528 [+] UCSC Ensembl
Mir-376-P1 chr12: 109723787-109723844 [+] UCSC Ensembl
Mir-154-P34 chr12: 109724322-109724384 [+] UCSC Ensembl
Mir-154-P9 chr12: 109726829-109726891 [+] UCSC Ensembl
Mir-154-P17 chr12: 109727346-109727403 [+] UCSC Ensembl
Mir-154-P21 chr12: 109728136-109728197 [+] UCSC Ensembl
Mir-544 chr12: 109729335-109729391 [+] UCSC Ensembl
Mir-154-P10 chr12: 109733781-109733838 [+] UCSC Ensembl
Mir-134 chr12: 109734143-109734205 [+] UCSC Ensembl
Mir-154-P15 chr12: 109734910-109734968 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUUCCUGCUGUGCUACUGUUUCAUACUUGAGGAGAAAUUAUCCUUGGUGUGUUGGCUCUUUUGGAUGAAUCAUACAAGGAUAAUUUCUUUUUGAGUAUCAAAUACUGCCCUGGUGGACUUCC
Get precursor sequence
Structure
        10          20        30        40        50        60 
AUUCCUGCUGUGCUACU--|   C     UG                 G    UUGGCUCUU 
                   GUUU AUACU  AGGAGAAAUUAUCCUUG UGUG         \
                   UAAA UAUGA  UUUUCUUUAAUAGGAAC AUAC         U
CCUUCAGGUGGUCCCGUCA^   C     GU                 -    UAAGUAGGU 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-154-P21_5p

MirBase accessionMIMAT0003169
Sequence
0- GGAGAAAUUAUCCUUGGUGUGUU -23
Get sequence
Validated targets microrna.org: MIMAT0003169
TargetScanVert: mmu-miR-539-5p
miRDB: MIMAT0003169
Star sequence

Mmu-Mir-154-P21_3p*

MirBase accessionMIMAT0017208
Sequence
40- CAUACAAGGAUAAUUUCUUUUU -62
Get sequence
Validated targets TargetScanVert: mmu-miR-539-3p
miRDB: MIMAT0017208