MirGeneDB

MirGeneDB ID

Mmu-Mir-154-P10

Family name MIR-154 (all species)
Seed AAGUUGU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-382
Paralogues Mmu-Mir-154-P1  Mmu-Mir-154-P2-v1  Mmu-Mir-154-P2-v2  Mmu-Mir-154-P3a-v1  Mmu-Mir-154-P3a-v2  Mmu-Mir-154-P4  Mmu-Mir-154-P5  Mmu-Mir-154-P6  Mmu-Mir-154-P7  Mmu-Mir-154-P8  Mmu-Mir-154-P9  Mmu-Mir-154-P12  Mmu-Mir-154-P13  Mmu-Mir-154-P14  Mmu-Mir-154-P15  Mmu-Mir-154-P17  Mmu-Mir-154-P18  Mmu-Mir-154-P19  Mmu-Mir-154-P20-v1  Mmu-Mir-154-P20-v2  Mmu-Mir-154-P21  Mmu-Mir-154-P22  Mmu-Mir-154-P26  Mmu-Mir-154-P29-v1  Mmu-Mir-154-P29-v2  Mmu-Mir-154-P30  Mmu-Mir-154-P34  Mmu-Mir-154-P36 
Orthologues Bta-Mir-154-P10  Cfa-Mir-154-P10  Cpo-Mir-154-P10  Dno-Mir-154-P10  Ete-Mir-154-P10  Hsa-Mir-154-P10  Mml-Mir-154-P10  Ocu-Mir-154-P10  Rno-Mir-154-P10 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(mm10)
chr12: 109733781-109733838 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P10)
Mir-376-P1 chr12: 109723787-109723844 [+] UCSC Ensembl
Mir-154-P34 chr12: 109724322-109724384 [+] UCSC Ensembl
Mir-154-P9 chr12: 109726829-109726891 [+] UCSC Ensembl
Mir-154-P17 chr12: 109727346-109727403 [+] UCSC Ensembl
Mir-154-P21 chr12: 109728136-109728197 [+] UCSC Ensembl
Mir-544 chr12: 109729335-109729391 [+] UCSC Ensembl
Mir-154-P10 chr12: 109733781-109733838 [+] UCSC Ensembl
Mir-134 chr12: 109734143-109734205 [+] UCSC Ensembl
Mir-154-P15 chr12: 109734910-109734968 [+] UCSC Ensembl
Mir-154-P1 chr12: 109738438-109738495 [+] UCSC Ensembl
Mir-154-P20-v1 chr12: 109739132-109739187 [+] UCSC Ensembl
Mir-154-P20-v2 chr12: 109739132-109739187 [+] UCSC Ensembl
Mir-154-P6 chr12: 109740515-109740574 [+] UCSC Ensembl
Mir-541 chr12: 109742422-109742487 [+] UCSC Ensembl
Mir-154-P36 chr12: 109743172-109743225 [+] UCSC Ensembl
Mir-154-P14 chr12: 109743303-109743358 [+] UCSC Ensembl
Mir-154-P5 chr12: 109743431-109743486 [+] UCSC Ensembl
Mir-154-P12 chr12: 109743729-109743784 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGUCUCUGCUUUUCUGUGGUACUUGAAGAGAAGUUGUUCGUGGUGGAUUCGCUUUACUUGUGACGAAUCAUUCACGGACAACACUUUUUUCAGUACCAAAUGCUACCUCUAAGGAUU
Get precursor sequence
Structure
        10          20        30         40        50        
UUGUCUCUGCUUUUCUG--|      U       A-           UG      CUUUA 
                   UGGUACU GAAGAGA  GUUGUUCGUGG  GAUUCG     C
                   ACCAUGA CUUUUUU  CAACAGGCACU  CUAAGC     U
UUAGGAAUCUCCAUCGUAA^      -       CA           UA      AGUGU 
      110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-154-P10_5p

MirBase accessionMIMAT0000747
Sequence
0- GAAGUUGUUCGUGGUGGAUUCG -22
Get sequence
Validated targets microrna.org: MIMAT0000747
TargetScanVert: mmu-miR-382-5p
miRDB: MIMAT0000747
Star sequence

Mmu-Mir-154-P10_3p*

MirBase accessionMIMAT0004691
Sequence
36- AAUCAUUCACGGACAACACUUU -58
Get sequence
Validated targets microrna.org: MIMAT0004691
miRDB: MIMAT0004691