MirGeneDB

MirGeneDB ID

Mmu-Mir-154-P13

Family name MIR-154 (all species)
Seed AGUAGAC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-411
Paralogues Mmu-Mir-154-P1  Mmu-Mir-154-P2-v1  Mmu-Mir-154-P2-v2  Mmu-Mir-154-P3a-v1  Mmu-Mir-154-P3a-v2  Mmu-Mir-154-P4  Mmu-Mir-154-P5  Mmu-Mir-154-P6  Mmu-Mir-154-P7  Mmu-Mir-154-P8  Mmu-Mir-154-P9  Mmu-Mir-154-P10  Mmu-Mir-154-P12  Mmu-Mir-154-P14  Mmu-Mir-154-P15  Mmu-Mir-154-P17  Mmu-Mir-154-P18  Mmu-Mir-154-P19  Mmu-Mir-154-P20-v1  Mmu-Mir-154-P20-v2  Mmu-Mir-154-P21  Mmu-Mir-154-P22  Mmu-Mir-154-P26  Mmu-Mir-154-P29-v1  Mmu-Mir-154-P29-v2  Mmu-Mir-154-P30  Mmu-Mir-154-P34  Mmu-Mir-154-P36 
Orthologues Bta-Mir-154-P13  Cfa-Mir-154-P13  Cpo-Mir-154-P13  Dno-Mir-154-P13  Ete-Mir-154-P13  Hsa-Mir-154-P13  Mml-Mir-154-P13  Ocu-Mir-154-P13  Rno-Mir-154-P13 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(mm10)
chr12: 109710190-109710245 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P13)
Mir-154-P7 chr12: 109709065-109709122 [+] UCSC Ensembl
Mir-154-P13 chr12: 109710190-109710245 [+] UCSC Ensembl
Mir-154-P2-v1 chr12: 109710643-109710697 [+] UCSC Ensembl
Mir-154-P2-v2 chr12: 109710644-109710696 [+] UCSC Ensembl
Mir-154-P8 chr12: 109711806-109711862 [+] UCSC Ensembl
Mir-154-P30 chr12: 109712361-109712416 [+] UCSC Ensembl
Mir-154-P3a-v2 chr12: 109712523-109712578 [+] UCSC Ensembl
Mir-154-P3a-v1 chr12: 109712523-109712578 [+] UCSC Ensembl
Mir-154-P26 chr12: 109712823-109712880 [+] UCSC Ensembl
Mir-154-P4 chr12: 109713503-109713562 [+] UCSC Ensembl
Mir-154-P18 chr12: 109715334-109715389 [+] UCSC Ensembl
Mir-154-P29-v1 chr12: 109715715-109715771 [+] UCSC Ensembl
Mir-154-P29-v2 chr12: 109715716-109715770 [+] UCSC Ensembl
Mir-666 chr12: 109717103-109717163 [+] UCSC Ensembl
Mir-154-P22 chr12: 109717268-109717326 [+] UCSC Ensembl
Mir-154-P19 chr12: 109718757-109718816 [+] UCSC Ensembl
Mir-667 chr12: 109720020-109720083 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUCGGCGUCUCUGUGUGGUACUUGGAGAGAUAGUAGACCGUAUAGCGUACGCUUUAUCUGUGACGUAUGUAACACGGUCCACUAACCCUCAGUAUCAAAUCCAUCCCCGAGGCCCC
Get precursor sequence
Structure
        10            20        30        40        50       
CUCGGCGUCUCUGUGUG----|    UG   AGA    A      AUA       CUUUA 
                     GUACU  GAG   UAGU GACCGU   GCGUACG     U
                     UAUGA  CUC   AUCA CUGGCA   UGUAUGC     C
CCCCGGAGCCCCUACCUAAAC^    --   CCA    C      CAA       AGUGU 
    110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-154-P13_5p

MirBase accessionMIMAT0004747
Sequence
0- UAGUAGACCGUAUAGCGUACG -21
Get sequence
Validated targets microrna.org: MIMAT0004747
TargetScanVert: mmu-miR-411-5p
miRDB: MIMAT0004747
Co-mature sequence

Mmu-Mir-154-P13_3p

MirBase accessionMIMAT0001093
Sequence
35- UAUGUAACACGGUCCACUAAC -56
Get sequence
Validated targets microrna.org: MIMAT0001093
TargetScanVert: mmu-miR-411-3p
miRDB: MIMAT0001093