MirGeneDB

MirGeneDB ID

Mmu-Mir-129-P2

Family name MIR-129 (all species)
Seed UUUUUGC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-129-2
Paralogues Mmu-Mir-129-P1 
Orthologues Aca-Mir-129-P2  Ami-Mir-129-P2  Bta-Mir-129-P2  Cfa-Mir-129-P2  Cpi-Mir-129-P2  Cpo-Mir-129-P2  Dno-Mir-129-P2  Dre-Mir-129-P2a  Dre-Mir-129-P2b  Ete-Mir-129-P2  Hsa-Mir-129-P2  Mml-Mir-129-P2  Oan-Mir-129-P2  Ocu-Mir-129-P2  Rno-Mir-129-P2  Sha-Mir-129-P2  Sto-Mir-129-P2  Tgu-Mir-129-P2  Xtr-Mir-129-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Chordata
Genome context
(mm10)
chr2: 94241376-94241439 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGAAGCGGGUAGACUGCCUUUCGCGAAUCUUUUUGCGGUCUGGGCUUGCUGUACAUAACUCAAUAGCCGGAAGCCCUUACCCCAAAAAGCAUUCGCGGAGGGCGCGCUCGGCGACGUGACUG
Get precursor sequence
Structure
        10          20        30         40        50        60 
GAAGAAGCGGGUAGACU--             -|      C   CU      GCUGUACAUAA 
                   GCCUUUCGCGAAU CUUUUUG GGU  GGGCUU           \
                   CGGGAGGCGCUUA GAAAAAC CCA  CCCGAA           C
GUCAGUGCAGCGGCUCGCG             C^      C   UU      GGCCGAUAACU 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-129-P2_5p

MirBase accessionMIMAT0000209
Sequence
0- CUUUUUGCGGUCUGGGCUUGC -21
Get sequence
Validated targets microrna.org: MIMAT0000209
TargetScanVert: mmu-miR-129-5p
miRDB: MIMAT0000209
Co-mature sequence

Mmu-Mir-129-P2_3p

MirBase accessionMIMAT0000544
Sequence
42- AAGCCCUUACCCCAAAAAGCAU -64
Get sequence
Validated targets microrna.org: MIMAT0000544
TargetScanVert: mmu-miR-129-2-3p
miRDB: MIMAT0000544