MirGeneDB

MirGeneDB ID

Hsa-Mir-129-P2

Family name MIR-129 (all species)
Seed UUUUUGC
Species Human (Homo sapiens)
MiRBase ID hsa-mir-129-2
Paralogues Hsa-Mir-129-P1 
Orthologues Aca-Mir-129-P2  Ami-Mir-129-P2  Bta-Mir-129-P2  Cfa-Mir-129-P2  Cpi-Mir-129-P2  Cpo-Mir-129-P2  Dno-Mir-129-P2  Dre-Mir-129-P2a  Dre-Mir-129-P2b  Ete-Mir-129-P2  Mml-Mir-129-P2  Mmu-Mir-129-P2  Oan-Mir-129-P2  Ocu-Mir-129-P2  Rno-Mir-129-P2  Sha-Mir-129-P2  Sto-Mir-129-P2  Tgu-Mir-129-P2  Xtr-Mir-129-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Chordata
Genome context
(hg38)
chr11: 43581408-43581471 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAAGCCGGCAUAUUCUGCCCUUCGCGAAUCUUUUUGCGGUCUGGGCUUGCUGUACAUAACUCAAUAGCCGGAAGCCCUUACCCCAAAAAGCAUUUGCGGAGGGCGCACUCGUCGAGAAGACGG
Get precursor sequence
Structure
        10          20        30         40        50        60 
AGAAGCCGGCAUAUUCU--             -|      C   CU      GCUGUACAUAA 
                   GCCCUUCGCGAAU CUUUUUG GGU  GGGCUU           \
                   CGGGAGGCGUUUA GAAAAAC CCA  CCCGAA           C
GGCAGAAGAGCUGCUCACG             C^      C   UU      GGCCGAUAACU 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-129-P2_5p

MirBase accessionMIMAT0000242
Sequence
0- CUUUUUGCGGUCUGGGCUUGC -21
Get sequence
Validated targets microrna.org: MIMAT0000242
TargetScanVert: hsa-miR-129-5p
miRDB: MIMAT0000242
Star sequence

Hsa-Mir-129-P2_3p*

MirBase accessionMIMAT0004605
Sequence
42- AAGCCCUUACCCCAAAAAGCAU -64
Get sequence
Validated targets microrna.org: MIMAT0004605
TargetScanVert: hsa-miR-129-2-3p
TargetMiner: hsa-miR-129-2-3p
miRDB: MIMAT0004605