MirGeneDB ID | Lan-Mir-2-o108 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Family name | MIR-2 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Species | Lingula (Lingula anatina) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Paralogues | Lan-Mir-2-o100 Lan-Mir-2-o101a Lan-Mir-2-o101b Lan-Mir-2-o102 Lan-Mir-2-o103 Lan-Mir-2-o104 Lan-Mir-2-o105 Lan-Mir-2-o106a Lan-Mir-2-o106b Lan-Mir-2-o107 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Orthologues | Gsp-Mir-2 Ple-Mir-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (locus) | L. anatina | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Node of Origin (family) | Protostomia | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genome context (LinAna_1.0) |
LFEI01000806: 164633-164697 [+] Ensembl | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Clustered miRNAs (< 50kb from Mir-2-o108) |
Mir-2-o104
LFEI01000806: 162292-162350 [+]
Ensembl
Mir-2-o105 LFEI01000806: 164274-164333 [+] Ensembl Mir-2-o108 LFEI01000806: 164633-164697 [+] Ensembl |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Seed | AUCACAG | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Precursor (pre-Mir +30nt flank) |
ACGGGUUUGCUGAUACCAUGCAGUCCUCAUCCAUCAAAGUGGCUGUGAAGCAAUGAUAUUGUCUACUGUUGUAUCACAGCCCCGCUUUGAUGAGCUGAGAUUCUGCAGUCGUUCUACCAUAACCCGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structure | 10 20 30 40 50 60 ACGGGUUUGCUGAUACCA UC- UC- --| A AUGAUAUU UGCAG CUCA CAUCAAAGU GGCUGUGA GCA \ ACGUC GAGU GUAGUUUCG CCGACACU UGU G CCCAAUACCAUCUUGCUG UUA CGA CC^ A UGUCAUCU 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Comment | It is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and how the multiple paralogues in lophotrochozoans relate to the four Mir-2 genes in arthropods. Thus all lophotrochozoan genes aside from Mir-2-P12 are classified as orphans pending further data and analysis. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Motifs | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Star sequence | Lan-Mir-2-o108_5p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
0- CCAUCAAAGUGGCUGUGAAGCA -22
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mature sequence | Lan-Mir-2-o108_3p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sequence |
41- UAUCACAGCCCCGCUUUGAUGAGC -65
Get sequence
|