MirGeneDB

MirGeneDB ID

Hsa-Mir-1251

Family name MIR-1251 (all species)
Seed CUCUAGC
Species Human (Homo sapiens)
MiRBase ID hsa-mir-1251
Paralogues
Orthologues Bta-Mir-1251  Cfa-Mir-1251  Cpo-Mir-1251  Dno-Mir-1251  Ete-Mir-1251  Mdo-Mir-1251  Mml-Mir-1251  Mmu-Mir-1251  Ocu-Mir-1251  Rno-Mir-1251  Sha-Mir-1251 
Node of Origin (locus) Theria
Node of Origin (family) Theria
Genome context
(hg38)
chr12: 97491913-97491971 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACCCGAGCGUCCAUGGGUCAGCUAUGUGGACUCUAGCUGCCAAAGGCGCUUCUCCUUCUGAACAGAGCGCUUUGCUCAGCCAGUGUAGACAUGGCCUGAUAAACAAUGGAACUUCUCC
Get precursor sequence
Structure
        10         20         30        40        50         
CACCCGAGCGUCCAUGG-    -|      GG  U  A    CCA        UCUCCUU 
                  GUCA GCUAUGU  AC CU GCUG   AAGGCGCU       \
                  UAGU CGGUACA  UG GA CGAC   UUUCGCGA       C
CCUCUUCAAGGUAACAAA    C^      GA  U  C    UCG        GACAAGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-1251_5p

MirBase accessionMIMAT0005903
Sequence
0- ACUCUAGCUGCCAAAGGCGCU -21
Get sequence
Validated targets microrna.org: MIMAT0005903
TargetScanVert: hsa-miR-1251-5p
miRDB: MIMAT0005903
Star sequence

Hsa-Mir-1251_3p*

MirBase accessionMIMAT0026741
Sequence
38- CGCUUUGCUCAGCCAGUGUAG -59
Get sequence
Validated targets TargetScanVert: hsa-miR-1251-3p
miRDB: MIMAT0026741