MirGeneDB

MirGeneDB ID

Dre-Mir-203-P2-v1

Family name MIR-203 (all species)
Seed UGAAAUG
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-203b
Paralogues Dre-Mir-203-P1-v1  Dre-Mir-203-P1-v2  Dre-Mir-203-P2-v2 
Orthologues
Node of Origin (locus) D. rerio
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr20: 27405891-27405949 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-203-P2-v1)
Mir-203-P2-v1 chr20: 27405891-27405949 [+] UCSC Ensembl
Mir-203-P2-v2 chr20: 27405891-27405949 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCACUUAACAUGUGGCUUCCUCUUUGGCCGAGUGGUUCUCAACAGUUCAACAGUUCUUUUGAUGAUUGUGAAAUGUUCAGGACCACUUGAUCAGACGAAGGACAAUUUCACCUCUGAAA
Get precursor sequence
Structure
        10        20          30        40        50         
CCACUUAACAUGUGGCUU  -  -|   GC           C    G    A   UUCUU 
                  CC UC UUUG  CGAGUGGUUCU AACA UUCA CAG     U
                  GG AG AGAC  GUUCACCAGGA UUGU AAGU GUU     U
AAAGUCUCCACUUUAACA  A  C^   UA           C    A    -   AGUAG 
       110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Star sequence

Dre-Mir-203-P2-v1_5p*

MirBase accessionMIMAT0003407
Sequence
0- AGUGGUUCUCAACAGUUCAACAG -23
Get sequence
Mature sequence

Dre-Mir-203-P2-v1_3p

MirBase accessionMIMAT0001865
Sequence
37- GUGAAAUGUUCAGGACCACUUG -59
Get sequence
Validated targets TargetScanFish: dre-miR-203b