MirGeneDB

MirGeneDB ID

Dan-Novel-7

Family name DAN-NOVEL-7 (all species)
Seed GAGAGGU
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) D. ananassae
Node of Origin (family) D. ananassae
Genome context
(Dana_caf1)
scaffold_12903: 554769-554835 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUCAGUGUUUUUUUUAAGAUAAUAAUUUUGUGAGAGGUCUAUCCUGACGCAUGUUUUAUUUUUUUGUUCAUCCUGCUUCAGGUUACACCUUCUCAAAGAGUUUUUAUCAAAGCCUCGUUUAUUUAUA
Get precursor sequence
Structure
        10          20        30         40        50        60  
UUCAGUGUUUUUUUUAA--     U      G    -|   C  U     C   UGUUUUAUUU 
                   GAUAA AAUUUU UGAG AGGU UA CCUGA GCA          U
                   CUAUU UUGAGA ACUC UCCA AU GGACU CGU          U
AUAUUUAUUUGCUCCGAAA     U      A    U^   C  U     U   CCUACUUGUU 
     120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Da
Mature sequence

Dan-Novel-7_5p

MirBase accessionNone
Sequence
0- UGAGAGGUCUAUCCUGACGCA -21
Get sequence
Star sequence

Dan-Novel-7_3p*

MirBase accessionNone
Sequence
45- CUUCAGGUUACACCUUCUCAAA -67
Get sequence