MirGeneDB

MirGeneDB ID

Dan-Novel-4

Family name DAN-NOVEL-4 (all species)
Seed AGGAGAA
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) D. ananassae
Node of Origin (family) D. ananassae
Genome context
(Dana_caf1)
scaffold_12903: 550400-550461 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUCACAUCCAGAAAAGUAUUAUCCUUUUGCAAGGAGAAUUUAAGCAGUGUAUGUUGGUAUUAACACACAUAGACUGCUAAUCUUCUUCUAUUGAAGGGAUAAUCGGAGCAACAAGUAGGUAU
Get precursor sequence
Structure
        10          20        30        40        50        60
AUCACAUCCAGAAAAGU--|           CA       UUUA      G    UUGGUA 
                   AUUAUCCUUUUG  AGGAGAA    AGCAGU UAUG      U
                   UAAUAGGGAAGU  UCUUCUU    UCGUCA AUAC      U
UAUGGAUGAACAACGAGGC^           UA       CUAA      G    ACACAA 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Novel-4_5p

MirBase accessionNone
Sequence
0- AAGGAGAAUUUAAGCAGUGUAUG -23
Get sequence
Star sequence

Dan-Novel-4_3p*

MirBase accessionNone
Sequence
39- UAGACUGCUAAUCUUCUUCUAUU -62
Get sequence