MirGeneDB

MirGeneDB ID

Dan-Novel-6

Family name DAN-NOVEL-6 (all species)
Seed AGAGGUA
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues
Orthologues
Node of Origin (locus) D. ananassae
Node of Origin (family) D. ananassae
Genome context
(Dana_caf1)
scaffold_12903: 550718-550780 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CUUAUGAAUAUCUUAUAUAAUAUCACUUUUGAGAGGUACGGAAUGCUUGUAUGUGACCUUGAACUUCAUGGAAGCAUUUGGCGUACAUCUAAAAAGUUAUAUUUAUUUCCCAAUAUCCCUCAG
Get precursor sequence
Structure
        10          20        30        40          50          
CUUAUGAAUAUCUUAUAU--     C      G   G     --|       G    UGACCU 
                    AAUAU ACUUUU AGA GUACG  GAAUGCUU UAUG      \
                    UUAUA UGAAAA UCU CAUGC  UUUACGAA GUAC      U
GACUCCCUAUAACCCUUUAU     U      A   A     GG^       G    UUCAAG 
 120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Mature sequence

Dan-Novel-6_5p

MirBase accessionNone
Sequence
0- GAGAGGUACGGAAUGCUUGUAUG -23
Get sequence
Star sequence

Dan-Novel-6_3p*

MirBase accessionNone
Sequence
38- UGGAAGCAUUUGGCGUACAUCUAAA -63
Get sequence