MirGeneDB

MirGeneDB ID

Cpi-Mir-1720

Family name MIR-1720 (all species)
Seed GAUCACC
Species Western painted turtle (Chrysemys picta bellii)
MiRBase ID cpi-mir-1720
Paralogues
Orthologues Ami-Mir-1720  Cli-Mir-1720  Gga-Mir-1720  Tgu-Mir-1720-P1  Tgu-Mir-1720-P2 
Node of Origin (locus) Archelosauria
Node of Origin (family) Archelosauria
Genome context
(chrPic1)
JH584649: 9125216-9125278 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-1720)
Mir-7-P2 JH584649: 9124972-9125035 [+] UCSC
Mir-1720 JH584649: 9125216-9125278 [+] UCSC
Precursor
(pre-Mir +30nt flank)
UGGGGCAGCCAGAUGCCACCUCUCCGUUUCUGAUCACCUCAGUUGUUGCUUUUGUGAGGAUCUCAAGAGAAAGCAAUGAGAGGGUGGGUCUGAAACCCAUACUUACAUCUGCCAGAGCAAGCA
Get precursor sequence
Structure
        10        20          30         40        50        60 
UGGGGCAGCCAGAUGCCACCUCUCC--     U  -|     CAG UG        GUGAGGA 
                           GUUUC GA UCACCU   U  UUGCUUUU       \
                           CAAAG CU GGUGGG   A  AACGAAAG       U
ACGAACGAGACCGUCUACAUUCAUACC     U  G^     AG- GU        AGAACUC 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Te Te Te To
Mature sequence

Cpi-Mir-1720_5p

MirBase accessionNone
Sequence
0- UGAUCACCUCAGUUGUUGCUUUU -23
Get sequence
Star sequence

Cpi-Mir-1720_3p*

MirBase accessionMIMAT0037934
Sequence
40- AAGCAAUGAGAGGGUGGGUCUGA -63
Get sequence