MirGeneDB

MirGeneDB ID

Cli-Mir-737

Family name MIR-737 (all species)
Seed UUUUUUU
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-737
Paralogues
Orthologues Aca-Mir-737  Ami-Mir-737  Cpi-Mir-737  Dre-Mir-737  Oan-Mir-737 
Node of Origin (locus) Osteichthyes
Node of Origin (family) Osteichthyes
Genome context
(colLiv2)
scaffold244: 3380836-3380896 [-]
Precursor
(pre-Mir +30nt flank)
UGGUUUUCUUGUUUGGUUGGUUUGGGUUGAGUUUUUUUAGGUUUUGAUUUUUAUUACAUCUUUGUACAAAAAUCAAAACGUAAAGAAAAUGCUGCAAAGAUAGAUUGUUCUGCUCUUGGAU
Get precursor sequence
Structure
        10        20            30        40        50          
UGGUUUUCUUGUUUGGUUGG---    -|  UGAG        G           UAUUACAU 
                       UUUG GGU    UUUUUUUA GUUUUGAUUUU        \
                       AAAC UCG    AAAGAAAU CAAAACUAAAA        C
UAGGUUCUCGUCUUGUUAGAUAG    G^  UA--        G           ACAUGUUU 
 .       110       100        90          80        70
Deep sequencing
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Mature sequence

Cli-Mir-737_5p (predicted)

MirBase accessionMIMAT0038667
Sequence
0- GUUUUUUUAGGUUUUGAUUUU -21
Get sequence
Star sequence

Cli-Mir-737_3p* (predicted)

MirBase accessionNone
Sequence
40- AAUCAAAACGUAAAGAAAAUG -61
Get sequence