MirGeneDB

MirGeneDB ID

Bta-Mir-105-P1

Family name MIR-105 (all species)
Seed CAAAUGC
Species Cow (Bos taurus)
MiRBase ID bta-mir-105a
Paralogues Bta-Mir-105-P2 
Orthologues Cfa-Mir-105-P1  Hsa-Mir-105-P1  Mml-Mir-105-P1  Ocu-Mir-105-P1 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(bosTau8)
chrX: 35018711-35018769 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-105-P1)
Mir-105-P1 chrX: 35018711-35018769 [-] UCSC Ensembl
Mir-105-P2 chrX: 35021165-35021222 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUUGCAGGACCUUCUGAGUGUGCAUCGUAGUCAAAUGCUCAGACUCCUGUGGUGGCUGCUCAUGCACCACGGAUGUUUGAGCAUGUGCUACGGUGUCUACUUUUGCUACAUUGCCGUCU
Get precursor sequence
Structure
        10          20        30        40        50         
GUUGCAGGACCUUCUGA--|  U         U  A          UC        GCUG 
                   GUG GCAUCGUAG CA AUGCUCAGAC  CUGUGGUG    C
                   CAU UGUGGCAUC GU UACGAGUUUG  GGCACCAC    U
UCUGCCGUUACAUCGUUUU^  C         -  G          UA        GUAC 
       110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-105-P1_5p

MirBase accessionMIMAT0009217
Sequence
0- UCAAAUGCUCAGACUCCUGUGGUG -24
Get sequence
Validated targets TargetScanVert: bta-miR-105a
Star sequence

Bta-Mir-105-P1_3p*

MirBase accessionNone
Sequence
36- CCACGGAUGUUUGAGCAUGUGCU -59
Get sequence