MirGeneDB

Gene name

Tca-Mir-31

Family name MIR-31 (all species)
MiRBase ID tca-mir-31
Paralogues
Orthologues Aca-Mir-31  Ami-Mir-31  Asu-Mir-31  Bfl-Mir-31  Bta-Mir-31  Cel-Mir-31  Cfa-Mir-31  Cgi-Mir-31  Cli-Mir-31  Cpi-Mir-31  Cpo-Mir-31  Cte-Mir-31  Dme-Mir-31-P1  Dme-Mir-31-P2  Dno-Mir-31  Dpu-Mir-31  Dre-Mir-31  Efe-Mir-31  Ete-Mir-31  Gga-Mir-31  Hsa-Mir-31  Lgi-Mir-31  Mml-Mir-31  Mmu-Mir-31  Ocu-Mir-31  Pfl-Mir-31  Pmi-Mir-31-P3  Pmi-Mir-31-P4  Pmi-Mir-31-P5a  Pmi-Mir-31-P5b  Rno-Mir-31  Sha-Mir-31  Sko-Mir-31  Spu-Mir-31  Xtr-Mir-31 
Node of Origin (gene) Vertebrata
Node of Origin (family) Bilateria
Genome context
(Tcas5.2)
LG7: 5938429-5938486 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAACAUUUCUUUUUUUCGGGAGGCAGAGCAGGCAAGAUGUCGGCAUAGCUGAAGGUGUUUGAAACGGCUAUGUCUCAUCCGGCCAACUUAAGCCUUCCUCGGCGGCUUUAAUAAAGC
Get precursor sequence
Structure
        10         20         30        40        50         
AAAACAUUUCUUUUUUUC-       A-|  CA   AA    UC          AAGGUG 
                   GGGAGGC  GAG  GGC  GAUG  GGCAUAGCUG      \
                   CCUUCCG  UUC  CCG  CUAC  CUGUAUCGGC      U
CGAAAUAAUUUCGGCGGCU       AA^  AA   GC    U-          AAAGUU 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Mature sequence

Tca-Mir-31_5p

MirBase accessionMIMAT0008362
Sequence
0- AGGCAAGAUGUCGGCAUAGCUGA -23
Get sequence
Seed sequenceGGCAAGA
Star sequence

Tca-Mir-31_3p*

MirBase accessionMIMAT0019106
Sequence
36- GGCUAUGUCUCAUCCGGCCAAC -58
Get sequence