MirGeneDB

Gene name

Hme-Mir-31

Family name MIR-31 (all species)
MiRBase ID
Paralogues
Orthologues Aae-Mir-31  Aca-Mir-31  Ami-Mir-31  Asu-Mir-31  Bfl-Mir-31  Bge-Mir-31  Bta-Mir-31  Cel-Mir-31  Cfa-Mir-31  Cgi-Mir-31  Cin-Mir-31  Cli-Mir-31  Cpi-Mir-31  Cpo-Mir-31  Cte-Mir-31  Dan-Mir-31-P1  Dan-Mir-31-P2  Dme-Mir-31-P1  Dme-Mir-31-P2  Dmo-Mir-31-P1  Dmo-Mir-31-P2  Dno-Mir-31  Dpu-Mir-31  Dre-Mir-31  Efe-Mir-31  Ete-Mir-31  Gga-Mir-31  Hsa-Mir-31  Lan-Mir-31-P6  Lan-Mir-31-P7  Lgi-Mir-31  Mdo-Mir-31  Mml-Mir-31  Mmu-Mir-31  Ocu-Mir-31  Pfl-Mir-31  Pmi-Mir-31-P3  Pmi-Mir-31-P4  Pmi-Mir-31-P5a  Pmi-Mir-31-P5b  Rno-Mir-31  Sha-Mir-31  Sko-Mir-31  Spu-Mir-31  Tca-Mir-31  Tgu-Mir-31  Xtr-Mir-31 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Hmel_1)
FASA01202097.1: 1291-1349 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UUAAUUUACAAGUAAAGCCGGUGGCUGGGAAGGCAAGAUGUCGGCAUAGCUGAUUGAUAUAAUAUACGGCUGUGUCACAUCGAGCCAGCUCAAUCCGCCGGCGUUCGACGUGAGAAGAA
Get precursor sequence
Structure
        10         20         30        40        50         
UUAAUUUACAAGUAAAG-       C-|   AA   AA     C          AUUGAU 
                  CCGGUGG  UGGG  GGC  GAUGU GGCAUAGCUG      A
                  GGCCGCC  ACUC  CCG  CUACA CUGUGUCGGC      U
AAGAAGAGUGCAGCUUGC       UA^   GA   AG     -          AUAUAA 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Mature sequence

Hme-Mir-31_5p

MirBase accessionNone
Sequence
0- AGGCAAGAUGUCGGCAUAGCUGA -23
Get sequence
Seed sequenceGGCAAGA
Star sequence

Hme-Mir-31_3p*

MirBase accessionNone
Sequence
37- GGCUGUGUCACAUCGAGCCAGC -59
Get sequence