MirGeneDB

MirGeneDB ID

Asu-Mir-31

Family name MIR-31 (all species)
Seed GGCAAGA
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-72
Paralogues
Orthologues Aae-Mir-31  Aca-Mir-31  Ami-Mir-31  Bfl-Mir-31  Bge-Mir-31  Bta-Mir-31  Cel-Mir-31  Cfa-Mir-31  Cgi-Mir-31  Cin-Mir-31  Cli-Mir-31  Cpi-Mir-31  Cpo-Mir-31  Cte-Mir-31  Dan-Mir-31-P1  Dan-Mir-31-P2  Dme-Mir-31-P1  Dme-Mir-31-P2  Dmo-Mir-31-P1  Dmo-Mir-31-P2  Dno-Mir-31  Dpu-Mir-31  Dre-Mir-31  Efe-Mir-31  Ete-Mir-31  Gga-Mir-31  Hme-Mir-31  Hsa-Mir-31  Lan-Mir-31-P6  Lan-Mir-31-P7  Lgi-Mir-31  Mdo-Mir-31  Mml-Mir-31  Mmu-Mir-31  Oan-Mir-31  Ocu-Mir-31  Pfl-Mir-31  Pmi-Mir-31-P3  Pmi-Mir-31-P4  Pmi-Mir-31-P5a  Pmi-Mir-31-P5b  Rno-Mir-31  Sha-Mir-31  Sko-Mir-31  Spu-Mir-31  Sto-Mir-31  Tca-Mir-31  Tgu-Mir-31  Xtr-Mir-31 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold618: 63636-63697 [+]
Precursor
(pre-Mir +30nt flank)
UCGCAUACGGUGCUGCUUGGUCGUGGGACCAGGCAAGAUGUUGGCAUAGCUGAACGAAGCUUCGGAUUCAGCCGUGCUACAUAAGGCCAUGCUCCCGCGCCGCCAUACAAUGCUCAACUUCA
Get precursor sequence
Structure
        10           20        30         40        50        60
UCGCAUACGGUGCUGCUU---| U       C  -   AAG    U    UA     ACGAAG 
                     GG CGUGGGA CA GGC   AUGU GGCA  GCUGA      C
                     CC GCGCCCU GU CCG   UACA UCGU  CGACU      U
ACUUCAACUCGUAACAUACCG^ -       C  A   GAA    -    GC     UAGGCU 
120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Mature sequence

Asu-Mir-31_5p

MirBase accessionMIMAT0021468
Sequence
0- AGGCAAGAUGUUGGCAUAGCUGA -23
Get sequence
Star sequence

Asu-Mir-31_3p*

MirBase accessionMIMAT0021469
Sequence
39- AGCCGUGCUACAUAAGGCCAUGC -62
Get sequence