MirGeneDB

MirGeneDB ID

Tgu-Mir-31

Family name MIR-31 (all species)
Seed GGCAAGA
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-31
Paralogues
Orthologues Aae-Mir-31  Aca-Mir-31  Ami-Mir-31  Asu-Mir-31  Bfl-Mir-31  Bge-Mir-31  Bta-Mir-31  Cel-Mir-31  Cfa-Mir-31  Cgi-Mir-31  Cin-Mir-31  Cli-Mir-31  Cpi-Mir-31  Cpo-Mir-31  Cte-Mir-31  Dan-Mir-31-P1  Dan-Mir-31-P2  Dme-Mir-31-P1  Dme-Mir-31-P2  Dmo-Mir-31-P1  Dmo-Mir-31-P2  Dno-Mir-31  Dpu-Mir-31  Dre-Mir-31  Efe-Mir-31  Ete-Mir-31  Gga-Mir-31  Hme-Mir-31  Hsa-Mir-31  Lan-Mir-31-P6  Lan-Mir-31-P7  Lgi-Mir-31  Mdo-Mir-31  Mml-Mir-31  Mmu-Mir-31  Oan-Mir-31  Ocu-Mir-31  Pfl-Mir-31  Pmi-Mir-31-P3  Pmi-Mir-31-P4  Pmi-Mir-31-P5a  Pmi-Mir-31-P5b  Rno-Mir-31  Sha-Mir-31  Sko-Mir-31  Spu-Mir-31  Sto-Mir-31  Tca-Mir-31  Xtr-Mir-31 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(taeGut3.2.4)
Z: 32186035-32186093 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAGAAAUUCCUUUAUGCAGAGCUGGAGAGGAGGCAAGAUGUUGGCAUAGCUGUUGAUCUAAAAACCUGCUAUGCCAACAUAUUGUCAUCUUUCCUGUCUGUUUGCGGCAGAGGGAAGUU
Get precursor sequence
Structure
        10           20        30        40        50         
AAGAAAUUCCUUUAUGC---|  G U      GA     G             UGUUGAUC 
                    AGA C GGAGAG  GGCAA AUGUUGGCAUAGC        \
                    UCU G CCUUUC  CUGUU UACAACCGUAUCG        U
UUGAAGGGAGACGGCGUUUG^  - U      UA     A             UCCAAAAA 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-31_5p

MirBase accessionMIMAT0014615
Sequence
0- AGGCAAGAUGUUGGCAUAGCUGU -23
Get sequence
Star sequence

Tgu-Mir-31_3p* (predicted)

MirBase accessionNone
Sequence
36- UGCUAUGCCAACAUAUUGUCAUC -59
Get sequence