MirGeneDB

Gene name

Pfl-Mir-281

Family name MIR-281 (all species)
MiRBase ID
Paralogues
Orthologues Asu-Mir-281  Bfl-Mir-281  Cel-Mir-281-P3  Cel-Mir-281-P4  Cgi-Mir-281  Cte-Mir-281  Dme-Mir-281-P1-v1  Dme-Mir-281-P1-v2  Dme-Mir-281-P2  Dpu-Mir-281  Efe-Mir-281-P5  Efe-Mir-281-P6  Efe-Mir-281-P7  Isc-Mir-281  Lgi-Mir-281-P8  Lgi-Mir-281-P9  Sko-Mir-281  Tca-Mir-281 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Pfl)
LD346606.1: 193921-193982 [-]
Precursor
(pre-Mir +30nt flank)
ACGUGCAAUGAAAUACGCUCCCUAUUGGCGAGGGGGGCAUCACCAUGGACGGUGAACAAAAAUCGAAAACUGUCAUGGAGUUGCUCUCUUAAUCUUAGGGUGCCUUAUCAUCCGACAACGUU
Get precursor sequence
Structure
        10           20        30        40        50        60 
ACGUGCAAUGAAAUACG---|U     UU  CG         UCA     G     GAACAAA 
                    C CCCUA  GG  AGGGGGGCA   CCAUG ACGGU       \
                    G GGGAU  CU  UUCUCUCGU   GGUAC UGUCA       A
UUGCAACAGCCUACUAUUCC^U     U-  AA         UGA     -     AAAGCUA 
120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-281_5p* (predicted)

MirBase accessionNone
Sequence
0- AGGGGGGCAUCACCAUGGACGGU -23
Get sequence
Mature sequence

Pfl-Mir-281_3p

MirBase accessionNone
Sequence
40- UGUCAUGGAGUUGCUCUCUUAA -62
Get sequence
Seed sequenceGUCAUGG