MirGeneDB

MirGeneDB ID

Aae-Mir-281

Family name MIR-281 (all species)
Seed AGAGAGC
Species Yellow fever mosquito (Aedes aegypti)
MiRBase ID aae-mir-281
Paralogues
Orthologues Asu-Mir-281  Bfl-Mir-281  Bge-Mir-281  Cbr-Mir-281-P3  Cbr-Mir-281-P4  Cel-Mir-281-P3  Cel-Mir-281-P4  Cgi-Mir-281  Cin-Mir-281  Cte-Mir-281  Dan-Mir-281-P1-v1  Dan-Mir-281-P1-v2  Dan-Mir-281-P2-v1  Dan-Mir-281-P2-v2  Dme-Mir-281-P1-v1  Dme-Mir-281-P1-v2  Dme-Mir-281-P2-v1  Dme-Mir-281-P2-v2  Dmo-Mir-281-P1-v1  Dmo-Mir-281-P1-v2  Dmo-Mir-281-P2-v1  Dmo-Mir-281-P2-v2  Dpu-Mir-281  Efe-Mir-281-P5  Efe-Mir-281-P6  Efe-Mir-281-P7  Hme-Mir-281  Isc-Mir-281  Lan-Mir-281-P9  Lan-Mir-281-P10  Lgi-Mir-281-P8  Lgi-Mir-281-P9  Pfl-Mir-281  Sko-Mir-281  Sto-Mir-281  Tca-Mir-281 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Aaeg_L3)
supercont1.957: 134462-134520 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUUCUUUCGCUGGUUUCGAAUAUGAAAAUAAAGAGAGCUAUCCGUCGACAGUAGGGAUAUGAUUCACUGUCAUGGAAUUGCUCUCUUUAUGUACAAUUCGAUAUUCAACAUGGGCCCAC
Get precursor sequence
Structure
        10           20        30        40         50         
GUUCUUUCGCUGGUUUC---|   A  AAA           UA-     C      AGGGAU 
                    GAAU UG   AUAAAGAGAGC   UCCGU GACAGU      \
                    CUUA AC   UAUUUCUCUCG   AGGUA CUGUCA      A
CACCCGGGUACAACUUAUAG^   -  AUG           UUA     -      CUUAGU 
       110       100         90        80         70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Fe Fe Fe Fe To To To
Mature sequence

Aae-Mir-281_5p

MirBase accessionMIMAT0014231
Sequence
0- AAGAGAGCUAUCCGUCGACAGUA -23
Get sequence
Star sequence

Aae-Mir-281_3p*

MirBase accessionMIMAT0014232
Sequence
36- CUGUCAUGGAAUUGCUCUCUUUA -59
Get sequence