MirGeneDB

Gene name

Dmo-Mir-281-P2-v1

Family name MIR-281 (all species)
MiRBase ID dmo-mir-281-2
Paralogues Dmo-Mir-281-P1-v1  Dmo-Mir-281-P1-v2  Dmo-Mir-281-P2-v2 
Orthologues Aae-Mir-281  Asu-Mir-281  Bfl-Mir-281  Bge-Mir-281  Cgi-Mir-281  Cin-Mir-281  Cte-Mir-281  Dan-Mir-281-P2-v1  Dan-Mir-281-P2-v2  Dme-Mir-281-P2-v1  Dme-Mir-281-P2-v2  Dpu-Mir-281  Hme-Mir-281  Isc-Mir-281  Pfl-Mir-281  Sko-Mir-281  Tca-Mir-281 
Node of Origin (gene) Drosophila
Node of Origin (family) Bilateria
Genome context
(Dmoj_caf1)
scaffold_6496: 6376080-6376147 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-281-P2-v1)
Mir-281-P2-v2 scaffold_6496: 6376080-6376147 [-] UCSC Ensembl
Mir-281-P1-v1 scaffold_6496: 6376244-6376308 [-] UCSC Ensembl
Mir-281-P1-v2 scaffold_6496: 6376245-6376307 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGUCCCUCAGUUCUGCGAAUAGCGAAAUGAAGAGAGCUAUCCGUCGACAGUCAAGUUAUAUACAUAUUUUAAUACUGUCAUGGAAUUGCUCUCUUUGUAUAAUAUUCGAAAAUCGACGAUAUAUAUG
Get precursor sequence
Structure
        10           20        30        40         50        60   
UUGUCCCUCAGUUCUGC---|    GCGAA UG        UA-     C      CAAGUUAUAU 
                    GAAUA     A  AAGAGAGC   UCCGU GACAGU          A
                    CUUAU     U  UUCUCUCG   AGGUA CUGUCA          C
GUAUAUAUAGCAGCUAAAAG^    AAUA- GU        UUA     -      UAAUUUUAUA 
      120       110       100         90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-281-P2-v1_5p

MirBase accessionMIMAT0009185
Sequence
0- AAGAGAGCUAUCCGUCGACAGU -22
Get sequence
Seed sequenceAGAGAGC
Co-mature sequence

Dmo-Mir-281-P2-v1_3p

MirBase accessionMIMAT0008642
Sequence
46- UGUCAUGGAAUUGCUCUCUUUG -68
Get sequence
Seed sequenceGUCAUGG