MirGeneDB

Gene name

Tca-Mir-281

Family name MIR-281 (all species)
MiRBase ID tca-mir-281
Paralogues
Orthologues Asu-Mir-281  Bfl-Mir-281  Cel-Mir-281-P3  Cel-Mir-281-P4  Cgi-Mir-281  Cte-Mir-281  Dme-Mir-281-P1-v1  Dme-Mir-281-P1-v2  Dme-Mir-281-P2  Dpu-Mir-281  Efe-Mir-281-P5  Efe-Mir-281-P6  Efe-Mir-281-P7  Isc-Mir-281  Lgi-Mir-281-P8  Lgi-Mir-281-P9  Pfl-Mir-281  Sko-Mir-281 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Tcas5.2)
LG7: 203928-203983 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUCAUGGGAUUGUUGUGCAAUUCGAAAAUGAAGAGAGCUAUCCGUCGACAGUAUAUAAUUUACACUGUCAUGGAGUUGCUCUCUUUAUGAACGAAUUCAAAAACAGCGAGGGAGUA
Get precursor sequence
Structure
        10         20        30        40         50        
AUCAUGGGAUUGUUGUGC-      AAA           UA-|    C      AUAUA 
                   AAUUCG   AUGAAGAGAGC   UCCGU GACAGU     \
                   UUAAGC   UAUUUCUCUCG   AGGUA CUGUCA     A
AUGAGGGAGCGACAAAAAC      AAG           UUG^    -      CAUUU 
    110       100        90        80        70         60
Deep sequencing
Go to detailed chart
CommentThere are Dicer sites -1 and -2 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ea Em Em Em Em Em Oo
Mature sequence

Tca-Mir-281_5p

MirBase accessionMIMAT0008384
Sequence
0- AAGAGAGCUAUCCGUCGACAGUA -23
Get sequence
Seed sequenceAGAGAGC
Star sequence

Tca-Mir-281_3p*

MirBase accessionMIMAT0008385
Sequence
34- CUGUCAUGGAGUUGCUCUCUUU -56
Get sequence