
MirGeneDB ID


Family name MIR-281 (all species)
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-281-1
Paralogues Dan-Mir-281-P1-v2  Dan-Mir-281-P2-v1  Dan-Mir-281-P2-v2 
Orthologues Aae-Mir-281  Asu-Mir-281  Bfl-Mir-281  Bge-Mir-281  Cgi-Mir-281  Cin-Mir-281  Cte-Mir-281  Dme-Mir-281-P1-v1  Dme-Mir-281-P1-v2  Dmo-Mir-281-P1-v1  Dmo-Mir-281-P1-v2  Dpu-Mir-281  Hme-Mir-281  Isc-Mir-281  Pfl-Mir-281  Sko-Mir-281  Sto-Mir-281  Tca-Mir-281 
Node of Origin (locus) Drosophila
Node of Origin (family) Bilateria
Genome context
scaffold_13266: 2568766-2568828 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-281-P1-v1)
Mir-281-P1-v1 scaffold_13266: 2568766-2568828 [+] Ensembl
Mir-281-P1-v2 scaffold_13266: 2568767-2568827 [+] Ensembl
Mir-281-P2-v1 scaffold_13266: 2568952-2569020 [+] Ensembl
Mir-281-P2-v2 scaffold_13266: 2568953-2569021 [+] Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30        40         50        60 
CUAGACUAUCUCGAAUG---|     CG  A           UG-     C      CCAGAUA 
                    CGAAUA  UG AUAAAGAGAGC   UCCGU GACAGU       \
                    GCUUAU  AU UGUUUCUCUCG   AGGUA CUGUCA       C
AUCACUAGCCUCGCUUCGCA^     A-  A           UUA     -      CAAUAUC 
 120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
Tissue expression
Mature sequence


MirBase accessionMIMAT0008428
Get sequence
Star sequence


MirBase accessionMIMAT0008429
Get sequence