MirGeneDB

Gene name

Dan-Mir-281-P1-v1

Family name MIR-281 (all species)
MiRBase ID dan-mir-281-1
Paralogues Dan-Mir-281-P1-v2  Dan-Mir-281-P2-v1  Dan-Mir-281-P2-v2 
Orthologues Aae-Mir-281  Asu-Mir-281  Bfl-Mir-281  Bge-Mir-281  Cgi-Mir-281  Cin-Mir-281  Cte-Mir-281  Dme-Mir-281-P1-v1  Dme-Mir-281-P1-v2  Dmo-Mir-281-P1-v1  Dmo-Mir-281-P1-v2  Dpu-Mir-281  Hme-Mir-281  Isc-Mir-281  Pfl-Mir-281  Sko-Mir-281  Tca-Mir-281 
Node of Origin (gene) Drosophila
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13266: 2568766-2568828 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-281-P1-v1)
Mir-281-P1-v2 scaffold_13266: 2568767-2568827 [+] UCSC Ensembl
Mir-281-P2-v1 scaffold_13266: 2568952-2569020 [+] UCSC Ensembl
Mir-281-P2-v2 scaffold_13266: 2568953-2569021 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUAGACUAUCUCGAAUGCGAAUACGUGAAUAAAGAGAGCUGUCCGUCGACAGUCCAGAUACCUAUAACACUGUCAUGGAAUUGCUCUCUUUGUAUAAUAUUCGACGCUUCGCUCCGAUCACUA
Get precursor sequence
Structure
        10           20        30        40         50        60 
CUAGACUAUCUCGAAUG---|     CG  A           UG-     C      CCAGAUA 
                    CGAAUA  UG AUAAAGAGAGC   UCCGU GACAGU       \
                    GCUUAU  AU UGUUUCUCUCG   AGGUA CUGUCA       C
AUCACUAGCCUCGCUUCGCA^     A-  A           UUA     -      CAAUAUC 
 120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Da
Mature sequence

Dan-Mir-281-P1-v1_5p

MirBase accessionMIMAT0008428
Sequence
0- AAAGAGAGCUGUCCGUCGACAGU -23
Get sequence
Seed sequenceAAGAGAG
Star sequence

Dan-Mir-281-P1-v1_3p*

MirBase accessionMIMAT0008429
Sequence
40- UGUCAUGGAAUUGCUCUCUUUGU -63
Get sequence