MirGeneDB

Gene name

Cte-Mir-29-P1

Family name MIR-29 (all species)
Species Polychaete worm (Capitella teleta)
MiRBase ID cte-mir-29a
Paralogues Cte-Mir-29-P2 
Orthologues Aae-Mir-29-P1d  Aca-Mir-29-P1a  Aca-Mir-29-P1b  Ami-Mir-29-P1a  Ami-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bge-Mir-29-P1c  Bge-Mir-29-P1d  Bta-Mir-29-P1a  Bta-Mir-29-P1b  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1a  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1a  Cli-Mir-29-P1b  Cpi-Mir-29-P1a  Cpi-Mir-29-P1b  Cpo-Mir-29-P1a  Cpo-Mir-29-P1b  Dan-Mir-29-P1c  Dan-Mir-29-P1d  Dme-Mir-29-P1c  Dme-Mir-29-P1d  Dmo-Mir-29-P1c  Dmo-Mir-29-P1d  Dno-Mir-29-P1a  Dno-Mir-29-P1b  Dpu-Mir-29-P1c  Dpu-Mir-29-P1d  Dre-Mir-29-P1a1  Efe-Mir-29-P1e  Efe-Mir-29-P1f  Ete-Mir-29-P1a  Ete-Mir-29-P1b  Gga-Mir-29-P1a  Gga-Mir-29-P1b  Hme-Mir-29-P1d  Hsa-Mir-29-P1a  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lan-Mir-29-P1g  Lan-Mir-29-P1h  Lgi-Mir-29-P1  Mdo-Mir-29-P1a  Mdo-Mir-29-P1b  Mml-Mir-29-P1a  Mml-Mir-29-P1b  Mmu-Mir-29-P1a  Mmu-Mir-29-P1b  Oan-Mir-29-P1a  Oan-Mir-29-P1b  Ocu-Mir-29-P1a  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1a  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1a  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1a  Sto-Mir-29-P1b  Tca-Mir-29-P1c  Tca-Mir-29-P1d  Tgu-Mir-29-P1a  Tgu-Mir-29-P1b  Xtr-Mir-29-P1a  Xtr-Mir-29-P1b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Capitella_teleta_v1.0)
scaffold_794: 6889-6954 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P1)
Mir-29-P2 scaffold_794: 7597-7666 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAUAUGCGCAUGAUAAUGGGGCUCUGGAAUCCUGGUUUUCUCUGGUGCAUAGAUUAACGCUUUGAAUUUGUGUCUAGCACCAUUUGAAAUCAGUUUUCCUGGGUGCUCACUCUCCUCUCACUUAAU
Get precursor sequence
Structure
        10         20         30        40        50        60   
AAUAUGCGCAUGAUAAU-   -|   U    UC        CUC      A    UUAACGCUU 
                  GGG GCUC GGAA  CUGGUUUU   UGGUGC UAGA         \
                  CUC UGGG CCUU  GACUAAAG   ACCACG AUCU         U
UAAUUCACUCUCCUCUCA   G^   U    UU        UUU      -    GUGUUUAAG 
    120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cte-Mir-29-P1_5p* (predicted)

MirBase accessionNone
Sequence
0- CCUGGUUUUCUCUGGUGCAUAGA -23
Get sequence
Mature sequence

Cte-Mir-29-P1_3p

MirBase accessionMIMAT0009513
Sequence
44- UAGCACCAUUUGAAAUCAGUUU -66
Get sequence
Seed sequenceAGCACCA