MirGeneDB

Gene name

Asu-Mir-29-P1

Family name MIR-29 (all species)
Species Large roundworm (Ascaris suum)
MiRBase ID asu-mir-83
Paralogues Asu-Mir-29-P2 
Orthologues Aae-Mir-29-P1d  Aca-Mir-29-P1a  Aca-Mir-29-P1b  Ami-Mir-29-P1a  Ami-Mir-29-P1b  Bfl-Mir-29-P1  Bge-Mir-29-P1c  Bge-Mir-29-P1d  Bta-Mir-29-P1a  Bta-Mir-29-P1b  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1a  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1a  Cli-Mir-29-P1b  Cpi-Mir-29-P1a  Cpi-Mir-29-P1b  Cpo-Mir-29-P1a  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dan-Mir-29-P1c  Dan-Mir-29-P1d  Dme-Mir-29-P1c  Dme-Mir-29-P1d  Dmo-Mir-29-P1c  Dmo-Mir-29-P1d  Dno-Mir-29-P1a  Dno-Mir-29-P1b  Dpu-Mir-29-P1c  Dpu-Mir-29-P1d  Dre-Mir-29-P1a1  Efe-Mir-29-P1e  Efe-Mir-29-P1f  Ete-Mir-29-P1a  Ete-Mir-29-P1b  Gga-Mir-29-P1a  Gga-Mir-29-P1b  Hme-Mir-29-P1d  Hsa-Mir-29-P1a  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lan-Mir-29-P1g  Lan-Mir-29-P1h  Lgi-Mir-29-P1  Mdo-Mir-29-P1a  Mdo-Mir-29-P1b  Mml-Mir-29-P1a  Mml-Mir-29-P1b  Mmu-Mir-29-P1a  Mmu-Mir-29-P1b  Oan-Mir-29-P1a  Oan-Mir-29-P1b  Ocu-Mir-29-P1a  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1a  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1a  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1a  Sto-Mir-29-P1b  Tca-Mir-29-P1c  Tca-Mir-29-P1d  Tgu-Mir-29-P1a  Tgu-Mir-29-P1b  Xtr-Mir-29-P1a  Xtr-Mir-29-P1b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(ASU_PRJNA80881_plustraces)
Scaffold122: 1621116-1621173 [+]
Precursor
(pre-Mir +30nt flank)
CAGUGAAAUCUUUCAUGGAGAUCUCUGAAUCCUGAAUUUGUUUGUGUGCUGGACAGAACCCAUCUCUAGCACCAUUUAAAUUCAGCAUUUCUGAGGUCGCAAAACUUCAGCGCUGAGC
Get precursor sequence
Structure
        10         20        30         40        50         
CAGUGAAAUCUUUCAUGGA-      U   UC-|        UU  U        CAGAA 
                    GAUCUC GAA   CUGAAUUUG  UG GUGCUGGA     \
                    CUGGAG CUU   GACUUAAAU  AC CACGAUCU     C
CGAGUCGCGACUUCAAAACG      U   UAC^        UU  -        CUACC 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
0h 11 12 24 46 64 6d 7d 8d 96 Em La Ov Se Sp Te Zy
Star sequence

Asu-Mir-29-P1_5p*

MirBase accessionMIMAT0021475
Sequence
0- CCUGAAUUUGUUUGUGUGCUGGA -23
Get sequence
Mature sequence

Asu-Mir-29-P1_3p

MirBase accessionMIMAT0021476
Sequence
36- UAGCACCAUUUAAAUUCAGCAU -58
Get sequence
Seed sequenceAGCACCA