MirGeneDB

Gene name

Pfl-Mir-29-P1

Family name MIR-29 (all species)
MiRBase ID
Paralogues Pfl-Mir-29-P2 
Orthologues Aca-Mir-29-P1a  Aca-Mir-29-P1b  Ami-Mir-29-P1a  Ami-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bta-Mir-29-P1a  Bta-Mir-29-P1b  Cel-Mir-29-P1  Cfa-Mir-29-P1a  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cli-Mir-29-P1a  Cli-Mir-29-P1b  Cpi-Mir-29-P1a  Cpi-Mir-29-P1b  Cpo-Mir-29-P1a  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dme-Mir-29-P1c  Dme-Mir-29-P1d  Dno-Mir-29-P1a  Dno-Mir-29-P1b  Dpu-Mir-29-P1c  Dpu-Mir-29-P1d  Dre-Mir-29-P1a1  Efe-Mir-29-P1e  Efe-Mir-29-P1f  Ete-Mir-29-P1a  Ete-Mir-29-P1b  Gga-Mir-29-P1a  Gga-Mir-29-P1b  Hsa-Mir-29-P1a  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lgi-Mir-29-P1  Mdo-Mir-29-P1a  Mdo-Mir-29-P1b  Mml-Mir-29-P1a  Mml-Mir-29-P1b  Mmu-Mir-29-P1a  Mmu-Mir-29-P1b  Ocu-Mir-29-P1a  Ocu-Mir-29-P1b  Pmi-Mir-29-P1  Rno-Mir-29-P1a  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1a  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Tca-Mir-29-P1c  Tca-Mir-29-P1d  Xtr-Mir-29-P1a  Xtr-Mir-29-P1b 
Node of Origin (gene) Bilateria
Node of Origin (family) Bilateria
Genome context
(Pfl)
LD346879.1: 81562-81623 [+]
Precursor
(pre-Mir +30nt flank)
GCAGCCAUAUCUUGUCUGUUGCCACGGUAACCUGGUUUCACUUGGUGCAUAGAGUCUUGCUGUCAAUCUCUAGCACCAUAUGAAAUCAGUUUCCUUUGGUAUCAUGUCCAUCACUAAUUCAU
Get precursor sequence
Structure
        10          20        30        40        50        60 
GCAGCCAUAUCUUGUCU--|U     C  U  C         CU      A    GUCUUGC 
                   G UGCCA GG AA CUGGUUUCA  UGGUGC UAGA       \
                   C AUGGU UC UU GACUAAAGU  ACCACG AUCU       U
UACUUAAUCACUACCUGUA^U     U  C  U         AU      -    CUAACUG 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Pt
Star sequence

Pfl-Mir-29-P1_5p*

MirBase accessionNone
Sequence
0- CCUGGUUUCACUUGGUGCAUAGA -23
Get sequence
Mature sequence

Pfl-Mir-29-P1_3p

MirBase accessionNone
Sequence
40- UAGCACCAUAUGAAAUCAGUUU -62
Get sequence
Seed sequenceAGCACCA