
Gene name


Family name MIR-29 (all species)
Species Roundworm (Caenorhabditis briggsae)
MiRBase ID cbr-mir-83
Paralogues Cbr-Mir-29-P2 
Orthologues Aae-Mir-29-P1d  Aca-Mir-29-P1a  Aca-Mir-29-P1b  Ami-Mir-29-P1a  Ami-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bge-Mir-29-P1c  Bge-Mir-29-P1d  Bta-Mir-29-P1a  Bta-Mir-29-P1b  Cel-Mir-29-P1  Cfa-Mir-29-P1a  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1a  Cli-Mir-29-P1b  Cpi-Mir-29-P1a  Cpi-Mir-29-P1b  Cpo-Mir-29-P1a  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dan-Mir-29-P1c  Dan-Mir-29-P1d  Dme-Mir-29-P1c  Dme-Mir-29-P1d  Dmo-Mir-29-P1c  Dmo-Mir-29-P1d  Dno-Mir-29-P1a  Dno-Mir-29-P1b  Dpu-Mir-29-P1c  Dpu-Mir-29-P1d  Dre-Mir-29-P1a1  Efe-Mir-29-P1e  Efe-Mir-29-P1f  Ete-Mir-29-P1a  Ete-Mir-29-P1b  Gga-Mir-29-P1a  Gga-Mir-29-P1b  Hme-Mir-29-P1d  Hsa-Mir-29-P1a  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lan-Mir-29-P1g  Lan-Mir-29-P1h  Lgi-Mir-29-P1  Mdo-Mir-29-P1a  Mdo-Mir-29-P1b  Mml-Mir-29-P1a  Mml-Mir-29-P1b  Mmu-Mir-29-P1a  Mmu-Mir-29-P1b  Oan-Mir-29-P1a  Oan-Mir-29-P1b  Ocu-Mir-29-P1a  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1a  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1a  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1a  Sto-Mir-29-P1b  Tca-Mir-29-P1c  Tca-Mir-29-P1d  Tgu-Mir-29-P1a  Tgu-Mir-29-P1b  Xtr-Mir-29-P1a  Xtr-Mir-29-P1b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
IV: 11660111-11660175 [-] UCSC Ensembl
(pre-Mir +30nt flank)
Get precursor sequence
        10            20        30        40        50        60  
AGGAAGCAGCAGAAGGCA----|   UC     A              U  A  U  CGGCGAUC 
                      CCAC  GAAAA ACUGAGUUUAUGUG GU CU GA        A
                      GGUG  CUUUU UGACUUAAAUAUAC CA GA CU        G
UAUAUUUUUGAACCGAGAGACA^   --     G              -  C  U  AGCAACGA 
   120       110       100          90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
Tissue expression
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 Cb Ea Ma Yo
Star sequence


MirBase accessionNone
Get sequence
Mature sequence


MirBase accessionMIMAT0001295
Get sequence
Seed sequenceAGCACCA